Check patentability & draft patents in minutes with Patsnap Eureka AI!

A pcr primer targeting 5`-utr gene to detect goose parvovirus with short beak dwarf syndrome

A goose parvovirus and gene detection technology, applied in the field of primers for detection of short beak dwarf syndrome goose parvovirus, can solve problems such as not seen, achieve small fragments, avoid false positive results of PCR detection, and have high sensitivity

Active Publication Date: 2021-09-17
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no research reports on the design of specific primers for 5'-UTR to detect SBDS-GPV at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pcr primer targeting 5`-utr gene to detect goose parvovirus with short beak dwarf syndrome
  • A pcr primer targeting 5`-utr gene to detect goose parvovirus with short beak dwarf syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 PCR detection method for detection of goose parvovirus with short beak dwarf syndrome

[0022] 1. Materials:

[0023] Short beak and dwarf syndrome goose parvovirus M15 strain (SBDS-GPV M15), genetically recombined Muscovy duck goose parvovirus PT strain (MDGPV PT), Muscovy duck parvovirus P strain (MDPV P) and classic goose parvovirus FJ strain (C-GPV FJ) were isolated, identified and preserved by the animal virus laboratory of the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0024] Two, steps

[0025] 1. Instruments and reagents: T100 gradient PCR instrument was purchased from Bio-Rad; pMD18-T vector and DL2000Marker were purchased from Bao Bio-Engineering (Dalian) Co., Ltd.; Q5 ultra-fidelity 2×Master Mix was purchased from NEB Company ; DNA purification kit E.Z.N.A.TM Gel Extraction Kit and plasmid rapid extraction kit E.Z.N.A.TM PlasmidMini Kit were purchased from Omega Corporation.

[0026] 2. Prime...

Embodiment 2

[0035] Example 2 Specific detection of short beak dwarf syndrome goose parvovirus PCR

[0036] Take the positive samples of duck tissues artificially infected with SBDS-GPV, C-GPV, MDGPV and MDPV, and the negative samples of healthy duck tissues. According to Example 1, the total DNA is extracted by conventional methods, PCR amplification is performed, and the results are detected by gel electrophoresis. Results A specific band of 130 bp was produced in the SBDS-GPV infected disease material, but none of the C-GPV, MDGPV, MDPV infected disease material and healthy duck tissue samples produced a specific band of 130 bp. The detection results are shown in Figure 1. The PCR products were recovered and purified, cloned into pMD18-T vector and sequenced. The results showed that the sequence of the amplified target fragment had the highest homology (95%-100%) with the corresponding sequence of the 5'-UTR of different virus isolates of SBDS-GPV published by GenBank. Therefore, the p...

Embodiment 3

[0038] Example 3 Sensitivity detection of short beak dwarf syndrome goose parvovirus PCR

[0039] The SBDS-GPV virus DNA was extracted by the conventional method according to Example 1, and the extracted DNA was serially diluted 10 times, and PCR amplification was performed to detect the relative sensitivity of the method. The results of PCR detection are shown in Figure 2. The specific primers SBDS-GPV-F1 (SEQ ID NO: 1) and SBDS-GPV-R1 (SEQ ID NO: 2) can detect the lowest relative DNA concentration sensitivity of 3 pg, and the sensitivity of the primers is good.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pair of PCR primers for detecting short beak dwarf syndrome goose parvovirus against the 5'-UTR gene, the primers are composed of upstream and downstream primers, and the upstream primer and its oligonucleotide sequence are SBDS-GPV-F1: 5′‑GCACGTGACAGGATGTGCGTCA‑3′; the sequence of the downstream primer and its oligonucleotide is SBDS‑GPV‑R1: 5′‑GCGCGCAAAATATTTTCT‑3′. The primers of the present invention have high specificity, small fragments, and high sensitivity. The entire PCR process can be completed within 2 hours, and can specifically detect the presence of short beak dwarf syndrome goose parvovirus, and can effectively avoid short beak dwarf syndrome. Occurrence of false-positive results in PCR detection of goose parvovirus.

Description

technical field [0001] The invention relates to a primer for detecting goose parvovirus with short beak dwarf syndrome, which belongs to the field of animal husbandry and veterinary detection. Background technique [0002] Short beak and dwarfism syndrome-gooseparvovirus (short beak and dwarfism syndrome-gooseparvovirus, SBDS-GPV) is a member of the Parvoviridae dependent virus genus, is a pan-tissue tropism single-stranded DNA virus, clinically mainly causes muscovy duck and cherry Valley duck is a highly contagious infectious disease characterized by growth disorder, short beak, exposed tongue, and easy bone breakdown. Under artificial infection conditions, it is infectious to different species of waterfowl. The disease was first reported by Villatte D. to be prevalent in French muscovy ducks. In 2009, Palya V. in Hungary isolated and identified the pathogen, and named it SBDS-GPV. In 2015, Chen Shaoying et al. SBDS-GPV infection was detected in the flock, and SBDS-GPV wa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12R1/93
CPCC12Q1/686C12Q1/701
Inventor 王劭陈少莺肖世峰陈仕龙程晓霞林锋强俞博朱小丽
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More