Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

40 results about "Goose parvovirus" patented technology

Goose parvovirus and applications thereof

The invention provides goose parvovirus (GPV) and applications thereof, and belongs to the technical field of biology. The invention provides a goose parvovirus GPV-YZ strain as well as applications thereof in preparing medicaments for preventing and treating the gosling plague disease. The microorganism preservation number is CGMCC NO.8160. The invention also provides a gosling plague disease viral vaccine as well as an anti-gosling plague yolk antibody. The goose parvovirus YZ strain provided by the invention has favorable immunogenicity for the present epidemic goose parvovirus, can resist toxicity attacking of the GPV-AV240 strain, the GPV-GD strain as well as the toxic strain of the goose parvovirus, and has the protection capability against the GPV-AV240 strain and the GPV-GD strain. After breeding geese are immunized by the gosling plague disease viral vaccine provided by the invention, young geese can be protected by maternal antibodies, and can be prevented from being infected by gosling plague viruses. The anti-gosling plague yolk antibody provided by the invention can prevent and treat gosling disease.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Preparation method of muscovy duck original goose parvovirus and duck type II adenovirus combined inactivate vaccine

The invention provides a preparation method of a muscovy duck original goose parvovirus and duck type II adenovirus combined inactivate vaccine. The preparation method is characterized in that targeted process conditions are designed according to the proliferation characteristics and immunogenicity of the muscovy duck original goose parvovirus and the duck type II adenovirus. Concretely, chick embryos are used for proliferating the muscovy duck original goose parvovirus; LMH cells are used for proliferating adenovirus; after being inactivated, the viruses are prepared into safe and effective muscovy duck original goose parvovirus and the duck type II adenovirus combined inactivate vaccine. When being used, the prepared muscovy duck original goose parvovirus and duck type II adenovirus combined inactivate vaccine has the advantages that the antibody generation is early; the protection rate is high. The vaccine can be used for preventing two diseases after once inoculation; the stress response caused by multi-time vaccine inoculation of the muscovy duck can be solved.
Owner:TIANJIN RINGPU BIO TECH

Recombinant Newcastle disease virus for expressing goose parvovirus VP3 genes and construction method thereof

The invention discloses a recombinant Newcastle disease virus for expressing goose parvovirus VP3 genes and a construction method thereof, belonging to the field of recombinant virus vaccines. The recombinant Newcastle disease virus is a goose isolate, the cleavage site amino acid sequence of F protein of the recombinant Newcastle disease virus is GRQGRL, and the P3 gene is positioned in a noncoding region between the P gene and M gene of Newcastle disease virus. The transcription plasmid pCI-NA-VP3(SEQ ID NO.1) and the transcription helper plasmid pcDNA-N, pcDNA-P and pcDNA-L(SEQ ID NO. 2-4) cotransfect a host cell licensed by application of the Newcastle disease virus to culture a transfected host cell, and the recombinant Newcastle disease virus can be saved from a cell suspension of the transfected host cell. The recombinant Newcastle disease virus for expressing goose parvovirus VP3 genes can be used as a bivalent living-vector vaccine for preventing Newcastle disease virus and goose parvovirus.
Owner:JILIN UNIV

Method for quickly building differential expression gene library

The invention discloses a method for quickly building a differential expression gene library. The method comprises the following steps of: firstly extracting total mRNA of infected goose parvovirus and uninfected goose parvovirus goose bursas of fabricius; synthesizing double strands cDNA for enzyme digestion by utilizing the obtained mRNA, and then separating into 2 pipes, respectively adding different adaptors for connecting; carrying out forward subtractive hybridization on the double strands cDNA with the adaptors, then carrying out reverse subtractive hybridization on a forward subtractive hybridization product, carrying out the primary PCR (polymerase chain reaction)) amplification after reverse subtractive hybridization, and carrying out the secondary PCR amplification by taking diluent as a template after diluting an amplification product; and finally carrying out denaturing gradient gel electrophoresis on a product of the second PCR amplification, and dying after electrophoresis to obtain the differential expression gene library of the goose parvovirus stress bursa of fabricius. The gene library built by the method does not have false positive. The method has the characteristics of high speed, high sensitivity, strong specificity, low cost, convenience in operation, and the like.
Owner:山东施得维特生物工程有限公司

Multiple fluorescent quantitative PCR detection primer and reagent kit for novel goose astrovirus, goose paramyxovirus and goose parvovirus, and application

The invention relates to the technical field of virus detection, in particular to a multiple fluorescent quantitative PCR detection primer pair for novel goose astrovirus, goose paramyxovirus and goose parvovirus, and an application of a specific probe. The established multiple fluorescent quantitative PCR system can accurately detect single or mixed infection of the novel goose astrovirus, the goose paramyxovirus and the goose parvovirus, the multiple fluorescent quantitative PCR system is optimized, the optimal primer concentration and the optimal probe concentration are determined, the detection precision is higher, and the multiple fluorescent quantitative PCR detection primer pair has important advantages in the field of virus identification.
Owner:POULTRY INST SHANDONG ACADEMY OF AGRI SCI

Multiplex PCR detection primer pairs for goose astrovirus, goose paramyxovirus and goose parvovirus, and detection method and application thereof

The invention relates to the technical field of virus detection, and specifically relates to multiplex PCR detection primer pairs for goose astrovirus, goose paramyxovirus and goose parvovirus; and the invention further relates to a detection method of the primer pairs and application of the primer pairs. The multiplex PCR system established by the invention is capable of accurately detecting simplex or mixed infection of waterfowl with the goose astrovirus, the goose paramyxovirus and the goose parvovirus. Moreover, the multiplex PCR system is optimized with determined optimal primer ratio, primer concentration and Premix rTaq enzyme; and thus, better DNA amplification effects of the 3 viruses are achieved. Therefore, the multiplex PCR system has higher detection accuracy, and thereby having important advantages in the field of virus identification.
Owner:POULTRY INST SHANDONG ACADEMY OF AGRI SCI

Colloidal gold test paper strip for detecting novel goose parvovirus and preparation method thereof

The invention discloses a colloidal gold test paper strip for detecting novel goose parvovirus. The colloidal gold test paper strip comprises a PVC plate, a sample pad, a combination pad, a cellulosenitrate membrane and water suction paper, wherein the sample pad, the combination pad, the cellulose nitrate membrane and the water suction paper are sequentially fixed onto the PVC plate through lapjoint; the combination pad is a glass fiber membrane which is combined with colloidal gold particles and marks the novel goose parvovirus monoclonal antibodies; a detection line and a quality controlline are sequentially arranged on the cellulose nitrate membrane in the sample flowing direction. The detection line coats the polyclonal antibodies of the rabbit-anti-novel goose parvovirus VP1 protein; the quality control line coats the goat-anti-mouse IgG antibodies. When the colloidal gold test paper strip is used for detecting the novel goose parvovirus, the detection time is short; the costis low; the result can be easily judged; the applicability is high; the colloidal gold test paper strip is very suitable for being used for detecting the novel goose parvovirus in primary level culture plants.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Duplex PCR method for rapidly identifying goose parvovirus and cherry valley duck source parvovirus

InactiveCN105821163AStrong specificityReduce non-specific amplification problemsMicrobiological testing/measurementDuplex pcrPcr method
The invention relates to a duplex PCR method for rapidly identifying the goose parvovirus and the cherry valley duck source parvovirus. New specific primers are designed and screened, various parameters in the reaction process are optimized, and the duplex PCR method, established with the group of primers, for the goose parvovirus and the cherry valley duck source parvovirus is high in specificity and sensibility and capable of being used for rapidly and accurately identifying the goose parvovirus and the new cherry valley duck source parvovirus. The established duplex PCR method is good in repeatability, high in reliability, low in cost, easy to implement and suitable for large-scale epidemiological investigation. It is proved through detection of 1500 samples that the duplex PCR method has high reliability; besides, identification can be carried out just through a common PCR instrument, the cost of primer synthesis is very low, and thus the cost of a reaction in the duplex PCR method is almost the same as that of a common PCR; experiment operation is also easy, and the duplex PCR method is suitable for the present production fact of the animal husbandry in China.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Duck SBDS (Short Beak and Dwarfism Syndrome) vaccine and preparation method thereof

The invention provides a duck SBDS (Short Beak and Dwarfism Syndrome) vaccine and a preparation method thereof. The preparation method is characterized by carrying out fusion expression on an optimized duck SBDS-GPV (Goose Parvovirus) VP2 gene and an interleukin-2 gene, and producing duck SBDS-GPV-like particles by utilizing a baculovirus / insect cell expression system; mixing the duck SBDS-GPV-like particles with a preservative and an adjuvant, thus preparing the duck SBDS vaccine. The duck SBDS vaccine provided by the invention has the advantages of high yield, low production cost, high immunogenicity, good safety, convenience in large-scale production and the like, and has a good immunoprophylaxis effect on duck SBDS.
Owner:CHANGCHUN SR BIOLOGICAL TECH

Goose astrovirus, goose parvovirus and goose calico virus multiple nano PCR detection primer pair, kit and application method

The invention relates to a goose astrovirus (GoAstV), goose parvovirus (GPV) and goose calico virus (GoCV) multiple nano PCR detection primer pair, a kit and an application method thereof. The kit comprises a reverse transcription mixed solution, an amplification reaction mixed solution, a negative control and a positive control. According to the method, a nano PCR detection application method for the goose astrovirus, the goose parvovirus and the goose calico virus is established, a multiple nano PCR reaction system is optimized, and the primer concentration, the annealing temperature, the rTaq DNA polymerase concentration, the nano particle diameter and the nano particle concentration are determined, so that the amplification effects of the three viruses of GoAstV, GPV and GoCV are better; and the method is high in sensitivity, good in specificity and high in stability, the detection method is easy to operate, convenient and rapid, the detection time can be greatly shortened, the diagnosis problem of GoAstV, GPV and GoCV mixed infection can be thoroughly solved, and the method is suitable for rapid detection in clinical laboratories.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE JIANGXI ACAD OF AGRI SCI

Immunofluorescent reagent used for detecting Muscovy duck gosling blast diseases

ActiveCN102426238ARapid diagnosisDirect immunofluorescence detection time is shortFluorescence/phosphorescenceAntigenImmunofluorescence
The invention discloses an immunofluorescent reagent used for detecting muscovy duck gosling blast diseases, which is characterized in that an anti-GPV hybridoma cell strain D11 strain is used for preparing anti-GPV monoclonal antibody, then the GPV monoclonal antibody is used for labeling fluorescein isothiocyanate (FITC) to prepare the immunofluorescent reagent used for detecting muscovy duck gosling blast diseases; the anti-GPV hybridoma cell strain D11 strain is preserved in CCTCC, the preservation date is April 15th, 2011, and the preservation number is C201120. The invention also discloses an application of the immunofluorescent reagent used for detecting muscovy duck gosling blast diseases in clinical quick diagnosis of the muscovy duck gosling blast diseases, and an application ofpositioning and identifying of goose parvovirus antigen in tissue cells.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Method for culturing goose parvovirus by using goose embryo fibroblast line

The invention provides a method for culturing goose parvovirus by using a goose embryo fibroblast line, belongs to the field of veterinary biological products, and solves the problem of low production efficiency of an existing goose parvovirus culturing method. The method comprises the following steps: culturing primary cells, namely cutting a goose embryo which well develops into small pieces, washing, digesting, blowing and dispersing digestive cells to obtain a cell suspension, culturing until the cells form complete monolayers so as to obtain the primary cells; establishing a goose embryo fibroblast line, namely removing a nutrient solution from the primary cells of the goose embryo fibroblast, washing, digesting and culturing until complete monolayer cells are formed to obtain F1-generation cells which can be passed by three generations; reproducing and harvesting, namely inoculating F1-F4-generation cells which form 70 percent of monolayer, and harvesting reproduced viruses when over 75 percent of cells is diseased. According to the method, the amount of harvested virus liquid is 255 times of the dose of primary cell inoculation culturing, and the virus titer of the virus liquid is 10-100 times higher than that of a virus liquid which is inoculated, cultured and harvested when 100 percent of monolayer is formed.
Owner:黑龙江省兽医科学研究所

Goose parvovirus protein capable of inducing goose embryo fibroblast apoptosis and preparation method thereof

The invention provides a goose parvovirus protein capable of inducing goose embryo fibroblast apoptosis. The goose parvovirus protein is a non-structural protein, the amino acid sequence of the protein is shown as SEQ ID NO.1, and the protein has a function of inducing goose embryo fibroblast apoptosis. The goose parvovirus protein has the beneficial effects that: the goose parvovirus protein capable of inducing goose embryo fibroblast apoptosis provided by the invention provides a theoretical basis for exploring a pathogenic mechanism of GPV infection on GEF cells, also provides a new thoughtfor preventing and treating GPV, and provides a direction for deep discussion of development of antiviral drugs and vaccines.
Owner:JILIN AGRICULTURAL UNIV

Gosling plague antibody test standard substance and preparation method thereof

The invention discloses a gosling plague antibody test standard substance and a preparation method thereof. The gosling plague antibody test standard substance includes a gosling plague agar diffusionantigen, a gosling plague positive serum and a gosling plague negative serum. Preparation of the gosling plague agar diffusion antigen includes the steps: inoculating a susceptible goose embryo witha goose parvovirus strain, and harvesting a goose embryo liquid, to obtain an antigen liquid; and adding a freeze-drying protective agent to the antigen liquid, and freeze-drying to obtain the goslingplague agar diffusion antigen. Preparation of the gosling plague positive serum includes the steps: inoculating a susceptible goose embryo with the goose parvovirus strain, and harvesting a goose embryo liquid, to obtain an antigen liquid; and concentrating and inactivating the antigen liquid to prepare a gosling plague immunogen, immunizing a healthy susceptible goose, sampling blood, separatingserum, and freeze-drying to obtain the gosling plague positive serum. Preparation of the gosling plague negative serum includes the steps: sampling an adult goose which is negative to a gosling plague antibody, separating serum, and freeze-drying to obtain the gosling plague negative serum. The gosling plague antibody test standard substance has the advantages of good specificity and high fixed value accuracy and has application prospects in prevention and control of gosling plague.
Owner:哈药集团生物疫苗有限公司

Method for cloning complete sequence of muscovy duck origin goose parvovirus genome encoding area

The invention discloses a method for cloning a complete sequence of a muscovy duck origin goose parvovirus genome encoding area. A viral genome DNA is extracted from muscovy duck embryo allantoic fluid containing a muscovy duck origin goose parvovirus; with the viral genome DNA as a template, a gene segment containing the complete sequence of the encoding area is amplified by virtue of designed specific primers; a target gene segment is connected with a carrier; and positive colonies are selected to be subjected to sequencing, so as to directly obtain the complete sequence of the muscovy duck origin goose parvovirus genome encoding area. Compared with a traditional method, the method disclosed by the invention has the characteristics of long amplified target segment, small experimental workload, low cost and high efficiency.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Virus-like particles of duck derived goose parvoviruses and preparation method of virus-like particles

The invention provides virus-like particles of duck derived goose parvoviruses. A recombinant baculovirus used for preparing the virus-like particles contains a nucleotide fragment encoding a VP2 protein; the amino acid sequence of the VP2 protein is SEQ ID NO:3; the sequence of the nucleotide fragment of an encoding gene is SEQ ID NO:4. The prepared virus-like particles are used for preparing a vaccine. The prepared vaccine has the advantages that after the vaccine immunizes the cairna moschata, the antibody level of the cairna moschata can be improved, the antibody level of parent sources ofoffspring of the cairna moschata is ensured, and the gosling plague virus infection of young cairna moschata caused by the cairna moschata derived gosling plague viruses is prevented.
Owner:YEBIO BIOENG OF QINGDAO

Extraction method of goose parvovirus DNA (deoxyribonucleic acid)

The invention relates to an extraction method of goose parvovirus DNA (deoxyribonucleic acid), belonging to the field of biotechnology. The extraction method comprises the following steps: adding equal-volume of chloroform to a goose embryo allantoic fluid containing goose parvovirus, vibrating at room temperature for 15-20 minutes, centrifuging at 3500 rpm for 10 minutes, sucking supernatant, then adding equal-volume of chloroform, vibrating, centrifuging, repeating three times, sucking the supernatant, adding the supernatant into an EP (electropolished) tube, boiling in boiling water for 3-5 minutes, centrifuging at 8000-10000 rpm for 5 minutes, and sucking the supernatant to obtain the goose parvovirus DNA. In the extraction method provided by the invention, only chloroform is used as the reagent, and the virus is split to the allantoic fluid and fat and protein large particles are removed by repeated freezing and thawing, boiling and centrifuging; and the extraction method is convenient for operation, has low cost and high efficiency and is convenient for laboratory operation.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Application of perylenequinone compound in preparation of feed for preventing and treating poultry viruses

The invention provides application of a perylenequinone compound in the preparation of feed for preventing and treating poultry viruses, and belongs to the technical field of biological engineering and agriculture. The invention relates to the preparation of the feed for preventing and treating the poultry viruses such as Marek's disease virus, avian leukosis virus subgroup J, chicken infectious anemia virus, avian reovirus, newcastle disease virus, infectious bursal disease virus, goose parvovirus, duck plague virus, avian influenza virus and the like by adding the perylenequinone compound into poultry feed. The perylenequinone compound comprises hypocrellin, elsinochrome, polyanticin, cladosporin, calphostin, cercosporin and the like, and has a series advantages of being convenient to extract, having good stability, having no obvious side effect for oral administration, realizing quick metabolism and the like. The dosage of the perylenequinone compound in the preparation of the feedfor preventing and treating the poultry viruses is 1-50umol of perylenequinone compound per kg by weight every day; the dosage of the perylenequinone compound in the preparation of the feed for preventing and treating the poultry viruses is 50umol-200umol of perylenequinone compound per kg by weight; moreover, the perylenequinone compound has very obvious effect of preventing and treating the poultry viruses, meanwhile can be produced through modern biotechnology, and can bring good economic and social benefits.
Owner:江苏竹红生物科技有限公司

A kind of goose parvovirus strain and application thereof

The invention provides a goose parvovirus strain with preservation number of CCTCC NO:V201811. The goose parvovirus strain can be used for preparing a vaccine for preventing goose parvovirus derived from muscovy duck. A prepared inactivated vaccine for the goose parvovirus is good in safety, and local or general adverse reactions caused by the vaccine are avoided. Analysis of characters, safety testing and potency testing data in storage life tests proves that various indexes are stable and effective; the immune effect of the vaccine is evaluated with a serological method and an immune challenge method, and results show that the prepared inactivated vaccine can provide effective immune protection for muscovy ducks and has good commercial development prospect.
Owner:SHANDONG SINDER TECH +1

Application of perylenequinone compound in preparation of feed for preventing and treating poultry viruses

The invention provides application of a perylenequinone compound in the preparation of feed for preventing and treating poultry viruses, and belongs to the technical field of biological engineering and agriculture. The invention relates to the preparation of the feed for preventing and treating the poultry viruses such as Marek's disease virus, avian leukosis virus subgroup J, chicken infectious anemia virus, avian reovirus, newcastle disease virus, infectious bursal disease virus, goose parvovirus, duck plague virus, avian influenza virus and the like by adding the perylenequinone compound into poultry feed. The perylenequinone compound comprises hypocrellin, elsinochrome, polyanticin, cladosporin, calphostin, cercosporin and the like, and has a series advantages of being convenient to extract, having good stability, having no obvious side effect for oral administration, realizing quick metabolism and the like. The dosage of the perylenequinone compound in the preparation of the feedfor preventing and treating the poultry viruses is 1-50umol of perylenequinone compound per kg by weight every day; the dosage of the perylenequinone compound in the preparation of the feed for preventing and treating the poultry viruses is 50umol-200umol of perylenequinone compound per kg by weight; moreover, the perylenequinone compound has very obvious effect of preventing and treating the poultry viruses, meanwhile can be produced through modern biotechnology, and can bring good economic and social benefits.
Owner:江苏竹红生物科技有限公司

A kind of recombinant Newcastle disease virus expressing goose parvovirus vp3 gene and its construction method

The invention discloses a recombinant Newcastle disease virus expressing goose parvovirus VP3 gene and a construction method thereof, belonging to the field of recombinant virus vaccines. The recombinant Newcastle disease virus is an isolated strain of goose origin, the cleavage site amino acid of its F protein is GRQGRL, and the P3 gene is located in the non-coding region between the P gene and the M gene of the Newcastle disease virus. The transcription plasmid pCI-NA-VP3 (SEQ ID NO.1) and the transcription helper plasmids pcDNA-N, pcDNA-P, pcDNA-L (SEQ ID NO.2-4) are co-transfected into host cells with Newcastle disease virus replication permission , culturing the transfected host cells, and the recombinant Newcastle disease virus can be rescued from the cell suspension of the transfected host cells. The recombinant Newcastle disease virus expressing the goose parvovirus VP3 gene of the invention can be used as a dual live carrier vaccine for preventing Newcastle disease and goose parvovirus.
Owner:JILIN UNIV

Duck-derived goose parvovirus artificial attenuated strain and application thereof

The invention relates to a goose parvovirus attenuated strain GPV-ZYM with the collection number of CGMCC No.15700 and application thereof to preventing ducks or gooses from being infected with duck short beak syndrome and / or gosling plague as a vaccine.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Biological product containing novel goose parvovirus and duck circovirus antigen-antibody complex

The invention provides a biological product containing a novel goose parvovirus and duck circovirus antigen-antibody compound. The biological product is prepared by the following steps: firstly, preparing an antigen-antibody compound from a novel goose parvovirus egg yolk antibody and a live vaccine thereof; preparing an antigen-antibody complex from the duck circovirus egg yolk antibody and duck circovirus Cap protein; and mixing the two antigen-antibody complexes, and adding a protective agent to finally form a biological product. The biological product can resist invasion of the novel goose parvovirus and the duck circovirus to an organism at the same time, and has good prevention and protection effects on the duck short beak and dwarf syndrome and the duck defeathering syndrome caused by the goose parvovirus and the duck circovirus.
Owner:TIANJIN RINGPU BIO TECH

A dual PCR method for rapid identification of goose parvovirus and cherry valley duck parvovirus

InactiveCN105821163BStrong specificityReduce non-specific amplification problemsMicrobiological testing/measurementDuplex pcrRapid identification
The invention relates to a duplex PCR method for rapidly identifying the goose parvovirus and the cherry valley duck source parvovirus. New specific primers are designed and screened, various parameters in the reaction process are optimized, and the duplex PCR method, established with the group of primers, for the goose parvovirus and the cherry valley duck source parvovirus is high in specificity and sensibility and capable of being used for rapidly and accurately identifying the goose parvovirus and the new cherry valley duck source parvovirus. The established duplex PCR method is good in repeatability, high in reliability, low in cost, easy to implement and suitable for large-scale epidemiological investigation. It is proved through detection of 1500 samples that the duplex PCR method has high reliability; besides, identification can be carried out just through a common PCR instrument, the cost of primer synthesis is very low, and thus the cost of a reaction in the duplex PCR method is almost the same as that of a common PCR; experiment operation is also easy, and the duplex PCR method is suitable for the present production fact of the animal husbandry in China.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

GPV and N-GPV common type detection primer and probe

The invention provides one group of GPV (Goose Parvovirus) and N-GPV (Novel-Goose Parvovirus) common type detection primer and probe. Sequences of the primer and the probe are as follows: an upstreamprimer NGG-F: 5'-TAGGGAGGAGTTAGAAGA-3'; a downstream primer NGG-R: 5'-CATCCATAGAATTGTCATAAGTA-3'; the sequence of a probe NGG-P is as follows: 5'-ACCTGGTAATTGTTCCTGCTTCTCT-3'; a 5'-end is labeled witha fluorescence reporter gene FAM and a 3'-end is labeled with a fluorescence quenching group Eclipse. A method has high sensitivity, good stability, strong specificity and good repeatability, can used for detecting N-GPV infection and can lay a foundation for subsequent researches of pathogenesis of the N-GPV and development of molecular epidemiology.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

PCR primers directed at 5'-UTR gene and used for detecting short beak and dwarfism syndrome-goose parvovirus

The invention discloses a pair of PCR primers directed at 5'-UTR gene and used for detecting the short beak and dwarfism syndrome-goose parvovirus. The primers are composed of an upstream primer and adownstream primer, wherein the upstream primer is SBDS-GPV-F1 and has an oligonucleotide sequence of 5'-GCACGTGACAGGATGTGCGTCA-3'; and the downstream primer is SBDS-GPV-R1 and has an oligonucleotidesequence of 5'-GCGCGCAAAATATTTTCT-3'. The primers provided by the invention have high specificity, small fragment size and high sensitivity; the whole PCR process can be completed within 2 hours; andthe primers can specifically detect the presence of the short beak and dwarfism syndrome-goose parvovirus, and effectively avoid false positive results in PCR detection of the short beak and dwarfismsyndrome-goose parvovirus.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Method for quickly building differential expression gene library

The invention discloses a method for rapidly constructing a differentially expressed gene library, comprising the following steps: first extracting total mRNA of goose bursa infected with goose parvovirus and non-infected goose parvovirus; using the obtained mRNA to synthesize double-stranded cDNA for enzyme digestion Digestion, and then divided into 2 tubes, adding different adapters for connection; first perform forward subtractive hybridization on the double-stranded cDNA with adapters, and then perform reverse subtractive hybridization on the forward subtractive hybridization products, and then reverse subtractive hybridization Perform the first PCR amplification, dilute the amplified product, and use the diluted solution as a template to perform the second PCR amplification; finally, the product of the second PCR amplification is subjected to denaturing gradient gel electrophoresis, and stained after electrophoresis. The differentially expressed gene library of goose parvovirus stressing the bursa of Fabricius is obtained; the gene library constructed by the method of the invention has no false positive, and has the characteristics of fast speed, high sensitivity, strong specificity, low cost, convenient operation and the like.
Owner:山东施得维特生物工程有限公司

A pcr primer targeting 5`-utr gene to detect goose parvovirus with short beak dwarf syndrome

The invention discloses a pair of PCR primers for detecting short beak dwarf syndrome goose parvovirus against the 5'-UTR gene, the primers are composed of upstream and downstream primers, and the upstream primer and its oligonucleotide sequence are SBDS-GPV-F1: 5′‑GCACGTGACAGGATGTGCGTCA‑3′; the sequence of the downstream primer and its oligonucleotide is SBDS‑GPV‑R1: 5′‑GCGCGCAAAATATTTTCT‑3′. The primers of the present invention have high specificity, small fragments, and high sensitivity. The entire PCR process can be completed within 2 hours, and can specifically detect the presence of short beak dwarf syndrome goose parvovirus, and can effectively avoid short beak dwarf syndrome. Occurrence of false-positive results in PCR detection of goose parvovirus.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Primer group for detecting gosling plague virus, goose paramyxovirus and duck plague virus as well as kit and detection method of primer group

The invention discloses a primer group for detecting gosling plague virus, goose paramyxovirus and duck plague virus as well as a kit and a detection method of the primer group. The primer group comprises a goose parvovirus detection primer, a goose paramyxovirus detection primer and a duck plague virus detection primer. The kit comprises the primer group. The multiple PCR detection method established by the invention can accurately detect single or mixed infection of the gosling plague virus, the goose paramyxovirus and the duck plague virus, is high in detection precision, and has important advantages in the field of virus identification.
Owner:赣州市畜牧水产研究所