Check patentability & draft patents in minutes with Patsnap Eureka AI!

Colloidal gold test paper strip for detecting novel goose parvovirus and preparation method thereof

A technology of goose parvovirus and colloidal gold test paper, which is applied in the field of colloidal gold test paper for detecting new goose parvovirus and its preparation, can solve the problems of complicated operation and time-consuming, and achieve simple operation, high sensitivity and high diagnostic results reliable effect

Active Publication Date: 2018-11-23
SHANDONG AGRICULTURAL UNIVERSITY
View PDF16 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the establishment of the above method has played an important role in the prevention, diagnosis and monitoring of the new goose parvovirus, it is limited in the inspection and quarantine of grass-roots farms due to its complicated operation, time-consuming and special equipment. , there is an urgent need to establish a rapid, sensitive, specific method that can be used for direct detection of new goose parvovirus in grass-roots farms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colloidal gold test paper strip for detecting novel goose parvovirus and preparation method thereof
  • Colloidal gold test paper strip for detecting novel goose parvovirus and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0050] For the preparation of colloidal gold, the method that the present invention adopts is as follows:

[0051] Use an electric heating mantle to boil 200ml of deionized water at 100°C under stirring at 200rpm, add 2ml of 1% chloroauric acid solution until boiling, then add 6ml of 1% trisodium citrate solution until the color does not change, and then heat for 10min, then stop heating. Stir for 15 minutes, return to room temperature, restore the volume, the preparation of colloidal gold is completed, and store at 4°C for later use.

[0052] The particle size of the colloidal gold particles prepared by the above method is 25-30nm. Good-quality colloidal gold particles are the prerequisite for obtaining excellent performance of colloidal gold test strips. Colloidal gold particles are not uniform in size and irregular in shape, which is not conducive to protein labeling, and it is easy to form bare gold particles. The prepared gold-labeled protein is unstable. , resulting in ...

Embodiment 1

[0061] Example 1: Preparation of monoclonal antibody against novel goose parvovirus

[0062] The new goose parvovirus virus liquid was inoculated with 11-day-old duck embryos to contain the virus in large quantities, the allantoic fluid was collected and the virus was concentrated by ultra-high-speed centrifugation, and the concentrated virus liquid was purified by sucrose density gradient centrifugation. The purified virus liquid was used as an immunogen to immunize 6-8 week-old Balb / c mice. The initial vaccination dose was 60ug / mouse, and then boosted every two weeks for a total of 3 booster immunizations. only. Before fusion, the mice were pulsed with purified virus again. The potency was detected by ELISA experiment. Mouse splenocytes were collected, fused with myeloma cells prepared in advance, and cultured with 1% HAT medium. After about 2 weeks of fusion, positive hybridoma cell lines were screened by indirect ELISA method, and the screened positive hybridoma cell li...

Embodiment 2

[0065] Example 2: Preparation of polyclonal antibody against novel goose parvovirus

[0066] Design a pair of specific primers for the whole gene sequence of the new goose parvovirus VP1, as follows:

[0067] Upstream primer: 5'CACCATGTCTACTTTTTTAGATTC 3' (SEQ ID NO.1);

[0068] Downstream primer: 5'TTACAGATTTTGAGTTAGA 3' (SEQ ID NO.2).

[0069] PCR technology was used to amplify to obtain the complete sequence of VP1 gene of 2199bp (as shown in SEQ ID NO.3). According to the principle of homologous recombination, using topoisomerase I, this gene was cloned into the prokaryotic expression vector pDE1, and the recombinant plasmid pDE1-VP1 was obtained. The recombinant plasmid was transformed into Escherichia coli E.coli BL21, and a large amount of expression was induced by IPTG at a final concentration of 0.2 mmol / L. After 6 hours, the expression amount reached a peak. The bacterial liquid was collected and the cells were lysed by ultrasonic waves, and the supernatant and pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a colloidal gold test paper strip for detecting novel goose parvovirus. The colloidal gold test paper strip comprises a PVC plate, a sample pad, a combination pad, a cellulosenitrate membrane and water suction paper, wherein the sample pad, the combination pad, the cellulose nitrate membrane and the water suction paper are sequentially fixed onto the PVC plate through lapjoint; the combination pad is a glass fiber membrane which is combined with colloidal gold particles and marks the novel goose parvovirus monoclonal antibodies; a detection line and a quality controlline are sequentially arranged on the cellulose nitrate membrane in the sample flowing direction. The detection line coats the polyclonal antibodies of the rabbit-anti-novel goose parvovirus VP1 protein; the quality control line coats the goat-anti-mouse IgG antibodies. When the colloidal gold test paper strip is used for detecting the novel goose parvovirus, the detection time is short; the costis low; the result can be easily judged; the applicability is high; the colloidal gold test paper strip is very suitable for being used for detecting the novel goose parvovirus in primary level culture plants.

Description

technical field [0001] The invention relates to the field of preventive veterinary examination, in particular to a colloidal gold test strip for detecting novel goose parvovirus and a preparation method thereof. Background technique [0002] Since the spring of 2010, an infectious disease has occurred in North China. The disease mainly causes ducklings to be stunted, the upper and lower beaks to shrink, the tongue to protrude and swell, and the tibia and wing bones to fracture easily in the late stage of infection. The disease mainly leads to a decline in the pass rate of meat ducks for slaughter, causing greater economic losses. According to the clinical symptoms, the disease was named short beak and long tongue syndrome. The Poultry Disease Research Institute of Shandong Agricultural University identified the pathogen as the new goose parvovirus. [0003] The new type of goose parvovirus is a non-enveloped single-stranded DNA virus belonging to the family Parvoviridae. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/531
CPCG01N33/531G01N33/558G01N33/56983G01N33/577G01N2333/015
Inventor 刁有祥唐熠于相龙
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More