Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

66 results about "Muscovy duck parvovirus" patented technology

GeXP (Gene Expression Profiler) detection kit for differentiating 11 kinds of duck viral diseases

The invention discloses a GeXP (Gene Expression Profiler) detection kit for differentiating 11 kinds of duck viral diseases. The invention provides a GeXP detection primer group for identifying or assisting to identify duck infectious disease pathogens, wherein the primer group consists of a primer pair A, a primer pair B, a primer pair C, a primer pair D, a primer pair E, a primer pair F, a primer pair G, a primer pair H, a primer pair I, a primer pair J, a primer pair K and a primer pair L. According to the GeXP detection kit, shown by experiments, the primer group, a PCR (Polymerase Chain Reaction) reagent and the primer pairs, provided by the invention, are used for simultaneously differentiating and detecting avian influenza viruses, H5, H7 and H9 subtype avian influenza viruses, duck hepatitis viruses, duck plague viruses, duck flaviviruses, newcastle disease viruses, egg drop syndrome viruses, muscovy duck reoviruses, muscovy duck parvoviruses and duck circoviruses and are good in specificity and high in sensitivity. The detection kit, which is simple and convenient and is high in flux, and a detection system are provided for the detection on common major duck infectious disease pathogens, so that the practical needs are better met, and application prospects are broad.
Owner:GUANGXI VETERINARY RES INST

Preparation method of Muscovy duck parvo novel vaccines

The invention relates to a preparation method of Muscovy duck parvo novel vaccines, which comprises the following steps of: using Muscovy duck parvovirus attenuated virus P1 strain (MPV-P1 strain with a preservation number of CCTCC NO:V201013) and Muscovy duck origin goose parvovirus attenuated virus D strain ( GPV-D strain with a preservation number of CCTCC NO:V201014) as seed viruses; proliferating viruses by applying the muscovy duck embryone fibroblast spinner culture technology to obtain cell toxic liquids; mixing the cell toxic liquids according to the proper proportion and freezing a dry protective agent to freeze and dry to research safe and effective Muscovy duck parvo novel vaccines. The young Muscovy ducks are inoculated once so as to prevent and control the Muscovy duck parvovirus infection and the Muscovy duck gosling blast dieases at the same time, thereby the stress reaction of the Muscovy ducks caused by immunization for many times is solved. The invention is suitable for scale production under the GMP (Good Manufacturing Practices) condition, and saves the production cost of the vaccines.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Muscovy duck parvovirus and application thereof

The invention aims to provide a Muscovy duck parvovirus. The Muscovy duck parvovirus is a YBMDV strain, and is preserved in the China General Microbiological Culture Collection Center of the China Committee Of Culture Collection For Microorganisms in the Institute of Microbiology Chinese Academy of Science at the address of No. 3, No. 1 yard, Beichen west road, Chaoyang District, Beijing, on November 11th, 2013; the preservation number is CGMCC No. 8504. The Muscovy duck parvovirus screened by the invention has the characteristics of low toxicity and high immunogenicity; dead embryo and embryo liquid can be obtained by vaccinating the Muscovy duck parvovirus to a Muscovy duck embryo; virus liquid can be collected after grinding and freeze thawing; a vaccine is prepared by ultrafiltration concentration, formalin inactivation, the addition of an adjuvant, and mixing and emulsification; the Muscovy duck parvovirus can improve antibody of the Muscovy duck, ensure parent source antibody level of an offspring, and prevent green duck parvovirus infection caused by Muscovy duck parvovirus; the vaccine has the advantages of high efficiency and good safety.
Owner:YEBIO BIOENG OF QINGDAO

PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for distinguishing goose parvovirus from muscovy duck parvovirus

The invention discloses a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for distinguishing a goose parvovirus from a muscovy duck parvovirus. According to the PCR-RFLP method, NS gene sequence digestion site difference is used for distinguishing the goose parvovirus from the muscovy duck parvovirus. The method comprises the following steps of: extracting DNA (deoxyribonucleic acid), carrying out PCR amplification to obtain an NS gene segment, and carrying out RFLP analysis after EcoRI digestion is carried out. The PCR-RFLP method for distinguishing the goose parvovirus from the muscovy duck parvovirus is simple and high in efficiency and accuracy.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Multiple PCR (Polymerase Chain Reaction) detection kit for duck hepatitis A virus 1 and 3 as well as MDPV (Muscovy Duck Parvovirus)

The invention discloses a multiple PCR (Polymerase Chain Reaction) detection kit for duck hepatitis A virus 1 and 3 as well as MDPV (Muscovy Duck Parvovirus). The detection kit contains three pairs of specific primers. Experimental results show the multiple PCR detection kit for duck hepatitis A virus 1 and 3 as well as MDPV can be applied to detecting the duck hepatitis A virus 1 and 3 and the MDPV. The multiple PCR detection kit has the advantages of being convenient to operate, high in sensitivity, strong in specificity and the like; furthermore, the multiple PCR detection kit can be clinically used for distinguishing and detecting the duck hepatitis A virus 1 and 3 and the MDPV, the time cost can be saved, and the pollution can be reduced.
Owner:GUANGXI VETERINARY RES INST

GeXP Detection Kits for Identification of 11 Kinds of Duck Virus Diseases

Provided herein is a GeXP detection kit for identification of 11 kinds of duck virus diseases. The detection kit includes a primer set for identifying or auxiliarily identifying pathogens of duck communicable diseases, including one or more of primer pair A, primer pair B primer pair C, primer pair D, primer pair E, primer pair F, primer pair G, primer pair H, primer pair I, primer pair J, primer pair K and primer pair L. The can kit detect, simultaneously avian influenza virus, subtype H5, H7 and H9 of avian influenza virus, duck hepatitis virus, duck enteritis virus, duck Tembusu virus, Newcastle disease virus, egg drop syndrome virus, Muscovy duck reovirus, Muscovy duck parvovirus and duck circovirus with the primer set, PCR reagent or primer pairs provided in the present invention.
Owner:GUANGXI VETERINARY RES INST

Triple polymerase chain reaction (PCR) kit for duck hepatitis virus type I, duck circoviruses and Muscovy duckling parvovirosis and application of triple PCR kit

The invention discloses a primer pair group and a kit for performing identification or auxiliary identification on duck-related viruses and application of the primer pair group and the kit. The primer pair group consists of three primer pairs, and the three primer pairs consist of two single-stranded deoxyribonucleic acids (DNA) which are shown as a sequence 1 and a sequence 2, a sequence 3 and asequence 4, and a sequence 5 and a sequence 6 respectively; and the duck-related viruses are at least one of Muscovy duckling parvovirosis, duck circoviruses and duck hepatitis virus type I. A triplepolymerase chain reaction (PCR) technology that three kinds of pathogens, namely the Muscovy duckling parvovirosis, the duck circoviruses and the duck hepatitis virus type I can be simultaneously detected and identified through one-time PCR is established, and has the advantages of high specificity and sensitivity (the lowest detection line is 1pg), low cost, high efficiency and the like; and moreover, an amplification result is directly determined by utilizing the difference of the length of amplified fragments in the aspect of primer design, so that the method is relatively simple, convenient, intuitive and practical during result determination.
Owner:GUANGXI VETERINARY RES INST

Triple vaccine special for Muscovy duck

The invention discloses a triple vaccine special for Muscovy duck, and the triple vaccine special for Muscovy duck uses Muscovy duck liver white-spot disease attenuated MWCA strain, Muscovy duck parvovirus attenuated P1 strain and Muscovy duck goose-origin parvovirus attenuated D strain as seed viruses, and respectively uses SPF chicken embryo fibroblast or Muscovy duck embryo fibroblast spinner cultivation technology to propagate virus and obtain the cell toxic liquid, and after mixing according to a proper proportion, a freeze-drying protective agent is added for freeze drying, and the triple live vaccine of Muscovy duck reovirus disease, Muscovy duck parvovirus disease and Muscovy duck gosling plague special for Muscovy duck is prepared; the triple vaccine can be used in the Muscovy duck culture region where the Muscovy duck reovirus disease, the Muscovy duck parvovirus disease and the Muscovy duck gosling plague are prevalent, and the purpose for preventing and controlling three diseases above can be realized by one-time immunization.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Egg yolk antibody for preventing and curing muscovy duck parvovirus diseases

The invention aims to provide an egg yolk antibody for preventing and curing muscovy duck parvovirus diseases, and the egg yolk antibody is prepared by using muscovy duck parvoviruses the preserving number of which is CGMCC (China General Microbiological Culture Collection Center) No.8504 as an antigen. The egg yolk antibody is characterized in that a muscovy duck parvoviruse YBMDP plant is inoculated with a muscovy duck embryo, a die embryo body and embryo liquid are respectively obtained and are grinded and are subjected to freeze thawing so as to obtain a virus solution, and the oil adjuvant mixing emulsification is added in the virus solution after ultrafiltration concentration and formaldehyde solution inactivation so as to obtain a vaccine. The vaccine is utilized to inoculate a laying hen, eggs are obtained, yolks are separated, and the antibody is obtained after inactivation and extraction and rectification. The prepared antibody can prevent ducklings from the parvovirus infection because of muscovy duck parvoviruses, and the egg yolk antibody has the advantages of high efficiency, good safety, high protection rate and the like.
Owner:YEBIO BIOENG OF QINGDAO

Preparation method of goose parvovims and muscovy duckling parvovirus bivalent egg yolk antibody

The invention provides a preparation method of a goose parvovims and muscovy duckling parvovirus bivalent egg yolk antibody. According to the technical scheme, an inactivated vaccine prepared from a goose parvovims GPV-HB strain and a market sold goose parvovims live vaccine are jointly used as a goose parvovims antigen; an inactivated vaccine prepared from muscovy duckling parvovirus MDPV-FJ strains is singly used as a muscovy duckling parvovirus antigen; the immune is totally performed for three times; the basic immune of the goose parvovims live vaccine and the self-made goose parvovims inactivated vaccine is performed once; the reinforced immune is performed twice; the interval between every two times is three weeks; the dose is 1ml / individual for each kind of vaccine in each time; theimmune times and the interval of the muscovy duckling parvovirus are identical to those of the goose parvovims, but the immune time is delayed for one week through being compared with that of the goose parvovims; the immune dose is 1ml / individual. Through the antigen and the immune measures, the valence of two antibodies in high-immunity eggs can reach the relatively high level. The egg yolk antibody prepared by the method provided by the invention can realize the simultaneous prevention and treatment on goose parvovims and muscovy duckling parvovirus diseases; the protection rate is very high.
Owner:TIANJIN RINGPU BIO TECH

Muscovy duck parvovirus inactivation vaccine and application thereof

The invention provides a Muscovy duck parvovirus inactivation vaccine which comprises an antigen and a vaccine adjuvant, wherein the antigen is inactivated Muscovy duck parvovirus, and the collection number of the Muscovy duck parvovirus is CGMCC No.8504. The Muscovy duck parvovirus inactivation vaccine provided by the invention is prepared by the steps of screening a Muscovy duck parvovirus YBMDP strain with low toxicity and high immunogenicity; inoculating and collecting the virus liquid; performing ultrafiltration concentration and formaldehyde solution inactivation; adding an oil adjuvant and mixing and emulsifying to obtain the vaccine. The vaccine provided by the invention can improve the antibody level of Muscovy duck, guarantee the maternal antibody level of the filial generation and prevent the duckling parvovirus infection caused by the Muscovy duck parvovirus; the vaccine has the advantages of high efficiency and good safety.
Owner:YEBIO BIOENG OF QINGDAO

Triple fluorogenic quantitative PCR detection primer, kit and method of DTMUV, EDSV and H9 subtype AIV

The invention discloses a triple fluorogenic quantitative PCR detection primer, kit and method of the duck tembusu virus disease, the egg drop syndrome virus and the H9 subtype avian influenza virus. The detection primer for the duck tembusu virus disease, the egg drop syndrome virus and the H9 subtype avian influenza virus is shown in SEQ ID NO.1-6. The detection primer and kit can detect the EDSV, the H9 AIV and the DTMUV at the same time. No cross reaction with duck plague virus, goose parovovirus, muscovy duck parvovirus and escherichia coli genomic DNA and duck hepatitis A virus 1, duck hepatitis A virus 3, muscovy duck reovirus and newcastle disease virus RNA exists. The lower limits of detection for EDSV nucleic acid, H9 AIV nucleic acid and DTMUV nucleic acid are 8.0 copies, 4.8 copies and 1.3 copies respectively. The detection primer, kit and method can be used for qualitative and quantitative detection for the EDSV, the H9 AIV and the DTMUV.
Owner:INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI

Fluorescent quantitative primer group for visual differential diagnosis of waterfowl parvoviruses

The invention discloses a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer group for visual detection on infection conditions of goose parvovirus (GPV) and muscovy duck parvovirus (MDPV) and a method thereof. According to the method, the detection on the infection conditions of GPV and MDPV is carried out by using dissolution curve temperature difference caused by the difference between nucleotide GC contents of GPV and MDPV specific gene fragment regions amplified by primers, and the infection conditions of GPV and MDPV can be subjected to visual differential diagnosis specifically by only combining the SYBR Green I based real-time fluorescent quantitative PCR primer group to dissolution curves which are automatically generated after reaction is ended. The method disclosed by the invention is simple and is relatively high in efficiency and accuracy.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Muscovy duck parvovirus VP3 genetic recombination fowl pox virus transfer vector and building method thereof

The invention discloses a Muscovy duck parvovirus VP3 genetic recombination fowl pox virus transfer vector and a building method thereof. The method includes: fowl pox virus genome is used as the template to amplify the homologous recombination arms TKL and TKR of TK genes, the TKL and TKR are connected into a TK fragment with multiple cloning sites (MCS), and the TK fragment is connected into a framework plasmid to obtain the plasmid pTK; a reverse serial connection expression box S is synthesized and inserted into the plasmid pTK to obtain the plasmid pTKS; VP3 genes are inserted into an MSC1 position behind an early promotor P7.5, and EGFP BGH pA is inserted into an MCS2 position behind a late promotor P11 to obtain the target transfer vector pTKS-VP3-EGFP. After the pTKS-VP3-EGFP transfects chicken embryonic fibroblast infected by the fowl pox virus, RT-PCR and fluorescent protein detection show that VP3 can be expressed normally. By the Muscovy duck parvovirus VP3 genetic recombination fowl pox virus transfer vector and the building method thereof, a foundation is laid on the further development of safe and efficient MDPV recombinant fowl pox virus vaccines.
Owner:INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI

Combined live vaccine for muscovy duck parvovirus disease and muscovy duck reovirus disease

The invention discloses preparation and application of a combined vaccine for a muscovy duck parvovirus disease and a muscovy duck reovirus disease; the combined vaccine adopts a muscovy duck parvovirus attenuated P1 strain (preservation number: CCTCC V201013) and a muscovy duck liver white-spot disease (muscovy duck reovirus disease) attenuated MWCA strain (preservation number: CGMCC 0667) as seed viruses; the seed viruses are proliferated by using muscovy duck embryo fibroblasts and SPF chicken embryo fibroblasts through culture in spinner flasks; the cell viral liquid is gained, mixed according to a proper proportion, and freeze-dried by adding a freeze-drying protective agent to obtain the combined live vaccine; the combined live vaccine is applicable to muscovy duck breeding areas with epidemic muscovy duck three-week diseases and liver white-spot diseases.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Method for establishing goose embryo epithelial cell line and established goose embryo epithelial cell line

The invention discloses a method for establishing goose embryo epithelial cell line and the established goose embryo epithelial cell line. The invention relates to the method for establishing the goose embryo epithelial cell line, which is characterized in that a primary goose tissue adherent method, a differential velocity enzymatic digestion and a monoclonal screening method are combined, so that primary culture condition can be optimized. The method has the advantages of simple operation process, and convenient popularization and application. The invention also relates to the goose embryo epithelial cell line established by the method, a preservation number of the goose embryo epithelial cell line is CCTCC NO: C2014137, The establishment of the goose embryo epithelial cell line solves the problem of no well-established goose source cell line in prior art. The invention also relates to a kit used for culturing and / or proliferating goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus, and is characterized in that a host cell to be infected is / or comprises the goose embryo epithelial cell line. The method for establishing the goose embryo epithelial cell line verifies the sensitive characteristic of the goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus.
Owner:SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY

Muscovy duck parvovirus and gosling plague bivalent vaccine

The invention provides a Muscovy duck parvovirus and gosling plague bivalent vaccine. The antigens used by the vaccine is inactivated Muscovy duck parvoviruses and Muscovy duck-source gosling plague viruses, the preservation number of the Muscovy duck parvoviruses is CGMCC No. 8504, and the preservation number of the Muscovy duck-source gosling plague viruses is CCTCC No. V201620. A preparation method of the Muscovy duck parvovirus and gosling plague bivalent vaccine includes: the Muscovy duck parvovirus YBMDP strains and Muscovy duck-source gosling plague virus YBGPV-M strains which are high in virus content and good in immunogenicity are screened, infected embryos and allantoic fluid are collected after duck embryo inoculation, and oil emulsion adjuvant is added for emulsification and mixing to obtain the vaccine after homogenization, ultrafiltration and concentration, and formaldehyde solution inactivation. The prepared vaccine can immunize breeding Muscovy ducks and increase the level of two types of antibodies of the breeding Muscovy ducks at the same time, guarantee the offspring maternal antibody level of the breeding Muscovy ducks, and prevent the young Muscovy duck parvovirus diseases caused by the Muscovy duck parvoviruses and gosling plague virus infection caused by the Muscovy duck-source gosling plague viruses.
Owner:YEBIO BIOENG OF QINGDAO

Preparation method of virus-like particles of muscovy duck parvovirus

The invention discloses a preparation method of virus-like particles of a muscovy duck parvovirus. The method comprises the following steps: cloning a gene VP3 of the muscovy duck parvovirus into a baculovirus transfer vector to obtain a recombinant transfer vector pFastBacl-VP3; converting a recombinant plasmid of the pFastBacl-VP3 into DH10Bac competent cells, and performing coated plate cultivation till blue-white spots appear; picking white single colonies, extracting a recombinant Bacmid DNA by an alkaline cracking method, and performing transfection on the recombinant Bacmid DNA to enable an insect cell Sf9 to grow to prepare a rcombinant bculovirus, wherein SDS-PAGE, Western blot and IFA results show that a recombinant protein VP3 is successfully expressed in the insect cell; infecting the insect cell with P3 replacing the virus, collecting cell cracking supernate, and performing sucrose density gradient centrifugal purification to obtain spherical virus-like particles with the diameter of about 20 to 25 nm, wherein the spherical virus-like particles are highly similar to natural DPVs (Duck Parvovirus).
Owner:朱善元 +1

Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer

The invention provides a muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer and method. The MDPV primer sequence is as follows: anupstream primer P1: TAATGGTGGCAGGAATGCACAGTTC, and a downstream primer P2: TGTTACCATGATGTCTGAAAT; the GPV primer sequence is as follows: an upstream primer P3: GAGGTAGACAGCAACAGAAA, and a downstream primer P4: GCTCGTCCGTGACCATA. Relevant research reports and invention patents about the dual real-time fluorescence quantitative PCR detection primer and method based on SYBR Green II capable of completely distinguishing all gene subtypes of GPV from MDPV are unavailable at present; the MDPV and GPV dual real-time fluorescence quantitative PCR detection primer and method provided by the invention appear for the first time in the relevant fields.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Muscovy duck parvovirus subunit vaccine

The invention aims to provide a muscovy duck parvovirus subunit vaccine. The muscovy duck parvovirus subunit vaccine comprises an antigen and a vaccine adjuvant, wherein the used antigen is muscovy duck parvovirus VP protein; and the amino acid sequence of the muscovy duck parvovirus VP protein is SEQ ID NO: 1. After muscovy ducks are inoculated with the vaccine prepared by the invention, the antibody level of the muscovy ducks can be improved, the maternal antibody level of filial generation is guaranteed, and young muscovy duck goose parvovirus infection caused by muscovy duck source goose parvovirus is prevented. If young muscovy ducks at the age of one day are inoculated with the vaccine, the young muscovy duck goose parvovirus infection caused by muscovy duck source goose parvovirus can be prevented effectively.
Owner:青岛真源生物技术有限公司

Duck adenovirus 2 and DPV (Muscovy duck parvovirus) disease combined inactivated vaccine

The invention provides a duck adenovirus 2 and DPV (Muscovy duck parvovirus) disease combined inactivated vaccine. Antigens are inactivated duck adenovirus 2 and DPV, wherein the preservation number of the DPV is CCTCC NO:V201812, and the preservation number of the duck adenovirus 2 is CCTCC No:V201633. The prepared duck adenovirus 2 and DPV disease combined inactivated vaccine is good in safety and any local and general side effects caused by the vaccine are prevented. The analysis for character, safety test and efficacy test data in retention period tests indicates that all indexes are stable and effective; the immune effect of the vaccine is evaluated with a serological method and an immune challenge method, a result shows that the combined inactivated vaccine can provide effective immune protection for ducks and has good commercialized development prospect.
Owner:SHANDONG SINDER TECH +1

Colloidal gold test strip capable of simultaneously detecting waterfowl source parvoviruses and preparation method

The invention relates to the field of animal medicine, and discloses a colloidal gold test strip capable of simultaneously detecting waterfowl source parvoviruses and a preparation method. The colloidal gold test strip comprises a base plate, a sample pad, a gold mark pad, a nitrocellulose membrane and an absorbent pad, the gold mark pad is coated with colloidal gold mark protein with gosling plague virus monoclonal antibodies I, detection lines and quality control lines are sequentially arranged on the nitrocellulose membrane along flowing directions of samples, the detection lines of the nitrocellulose membrane are coated with gosling plague virus monoclonal antibodies II, and the quality control lines of the nitrocellulose membrane are coated with goat-anti-mouse IgG (intravenous gamma globulin) antibodies. The colloidal gold test strip can simultaneously detect goose parvoviruses, Muscovy duck parvoviruses and novel Muscovy duck parvoviruses, false positive of reaction is reduced to a great extent, and specificity and sensitivity of detection are improved.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI +1

Vaccine composition, and preparation method and application thereof

InactiveCN104288766AImmunity builds up fastProtectAntiviralsAntibody ingredientsMaternal antibodyAntigen
The invention provides a vaccine composition, comprising an immune amount of muscovy duck Parvovirus antigen and an immune amount of muscovy duck parvovirus antibody. The vaccine composition can be applied to immunization of young muscovy duck, also can be directly applied to immunization of muscovy duck embryo; the immunization effect is not affected by maternal antibody, and quickly produces immunity, and ideal protection can be produced of the in the second day after immunization; attacked by strong virus, the immune ducks 5 / 5 have no morbidity, and control ducks 5 / 5 are dead.
Owner:PU LIKE BIO ENG

Method for preparing serum for resisting Muscovy duck parvovrius

The invention discloses a method for preparing serum for resisting Muscovy duck parvovirus, which comprises the following steps of: preparing the Muscovy duck parvovirus; preparing a primary immune Muscovy duck parvovirus antigen; preparing a secondary immune Muscovy duck parvovirus antigen; preparing a Freund's incomplete adjuvant vaccine for the Muscovy duck parvovirus from the secondary immuneMuscovy duck parvovirus antigen; preparing a Freund's complete adjuvant vaccine for the Muscovy duck parvovirus from the primary immune Muscovy duck parvovirus antigen; and immunizing the Muscovy duck by using the prepared antigens and vaccines to obtain the serum for resisting the Muscovy duck parvovirus. The serum prepared by the method has high titer, and has obvious effect of preventing and controlling the Muscovy duck parvovirus; the prevention rate of the serum is 96.6 percent; and the cure rate of the serum is about 70 percent.
Owner:ZHENGZHOU HOUYI PHARMA

Muscovy duck parvovirus infectious clone construction and saving method

The invention relates to the technical field of biology, in particular to a MDPV (Muscovy duck parvovirus) infectious clone construction and saving method. The method includes: cloning an intact MDPV genome into vector plasmids pBSKN to obtain recombinant plasmids; mixing the recombinant plasmids with a transfection agent, and performing inoculation of nonimmune muscovy duck's embryon through the chorioallantoic membrane to save the recombinant plasmids in the muscovy duck's embryon, wherein a pBSKN vector is obtained by replacement of original EcoRV enzyme digestion sites of commercialized plasmid pBluescript II (SK) multiple clone sites with NcoI sites. Generated infectious viruses are lethal to the muscovy duck's embryon, and saving viruses and parent viruses are similar in lethality rate of young muscovy ducks. The saving method is simple, convenient and efficient, problems of low efficiency and complexity caused by transfection of primary cells are avoided, and potential application values in MDPV reverse genetic research and vaccine creation are achieved.
Owner:YANGZHOU UNIV

N-MDPV (novel Muscovy duck parvovirus) detection primer and probe and application thereof

The invention provides a N-MDPV (novel Muscovy duck parvovirus) detection primer and probe and application thereof. The sequences of the primer and the probe are as follows: upstream primer NMM-F: 5'-TACGAATGAACAAACCAA-3'; downstream primer NMM-R: 5'-CGCTCTTAATATCTCCTCTA-3'; probe NMM-P: 5'-TGAACGAGCGAATGAGCCTTCC-3', wherein the 5'- end marks a fluorescence report group FAM, and the 3'- end marksa fluorescence quenching group Eclipse. The method has the advantages of high sensitivity, good stability, strong specificity and high repeatability and can be used for detecting N-MDPV infection, andlays a foundation for follow-up study of the pathogenesis of N-MDPV and development of molecular epidemiology.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Muscovy duckling parvovirus LAMP (loop-mediated isothermal amplification) detection reagent kit

The invention discloses a muscovy duckling parvovirus LAMP (loop-mediated isothermal amplification) detection reagent kit. A loop-mediated isothermal amplification primer group for detecting muscovy duckling parvoviruses is provided and comprises a primer 1, a primer 2, a primer 3 and a primer 4, and nucleotide sequences of the primer 1, the primer 2, the primer 3 and the primer 4 are sequence 1, sequence 2, sequence 3 and sequence 4 in a sequence table sequentially. Experiments prove that six primers aiming at eight specific areas are designed by the aid of conserved sequence design of MDPV (muscovy duckling parvoviruses), the muscovy duckling parvovirus LAMP detection reagent kit is more specific and sensitive than a conventional detection method when used for LAMP detection, only one temperature-controllable water bath kettle needs to be used, and results can be judged by naked eyes without apparatuses. Therefore, the muscovy duckling parvovirus LAMP detection reagent kit is suitable for rapid detection of grass-root veterinary stations and livestock farms and has good application prospect.
Owner:GUANGXI VETERINARY RES INST

Bonamia LAMP (loop-mediated isothermal amplification) detection kit

The invention discloses a Bonamia LAMP (loop-mediated isothermal amplification) detection kit. The invention provides a loop-mediated isothermal amplification primer group for detecting Bonamia, and the primer group comprises a primer 1, a primer 2, a primer 3 and a primer 4, wherein the nucleotide sequences of the primer 1, the primer 2, the primer 3 and the primer 4 are respectively and sequentially sequence 1, sequence 2, sequence 3 and sequence 4 in a sequence table. Proven by an experiment, six primers aiming at eight special regions are designed according to the conserved sequences of MDPV (muscovy duck parvovirus), and the six primers are used for carrying out LAMP detection and have the advantages of being more special and more sensitive than a conventional detection method, only one water bath kettle with controllable temperature is used, and the result can be judged by eyes without instruments; and the detection kit is suitable to rapid detection in primary veterinary stations and on livestock farms and has a good application prospect.
Owner:GUANGXI VETERINARY RES INST

Method for identifying new goose parovovirus

The invention discloses a method for identifying new goose parovovirus. The fluorescent quantitation PCR detection method is high in flexibility and capable of detecting 10 copy number of gene of thenew goose parovovirus while an ordinary PCR only can detect 104 copy number, and the flexibility is higher 1000 times; the specificity is high, according to the difference region between classic gooseparovovirus and the new goose parovovirus and the difference region between muscovy duck parvovirus and the new goose parovovirus, a pair of specificity primers are designed and synthesized, and thegene fragments of the new goose parovovirus can be specifically amplified; the repeatability is high, analysis can be accurately and quickly conducted, and application and popularization in clinical practices are facilitated.
Owner:SOUTH CHINA AGRI UNIV +1

A method for establishing goose embryo epithelial cell line and established goose embryo epithelial cell line

The invention discloses a method for establishing goose embryo epithelial cell line and the established goose embryo epithelial cell line. The invention relates to the method for establishing the goose embryo epithelial cell line, which is characterized in that a primary goose tissue adherent method, a differential velocity enzymatic digestion and a monoclonal screening method are combined, so that primary culture condition can be optimized. The method has the advantages of simple operation process, and convenient popularization and application. The invention also relates to the goose embryo epithelial cell line established by the method, a preservation number of the goose embryo epithelial cell line is CCTCC NO: C2014137, The establishment of the goose embryo epithelial cell line solves the problem of no well-established goose source cell line in prior art. The invention also relates to a kit used for culturing and / or proliferating goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus, and is characterized in that a host cell to be infected is / or comprises the goose embryo epithelial cell line. The method for establishing the goose embryo epithelial cell line verifies the sensitive characteristic of the goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus.
Owner:SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More