Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer

Abstract

The invention provides a muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer and method. The MDPV primer sequence is as follows: anupstream primer P1: TAATGGTGGCAGGAATGCACAGTTC, and a downstream primer P2: TGTTACCATGATGTCTGAAAT; the GPV primer sequence is as follows: an upstream primer P3: GAGGTAGACAGCAACAGAAA, and a downstream primer P4: GCTCGTCCGTGACCATA. Relevant research reports and invention patents about the dual real-time fluorescence quantitative PCR detection primer and method based on SYBR Green II capable of completely distinguishing all gene subtypes of GPV from MDPV are unavailable at present; the MDPV and GPV dual real-time fluorescence quantitative PCR detection primer and method provided by the invention appear for the first time in the relevant fields.

Description

technical field [0001] The invention belongs to the field of preventive veterinary medicine, and relates to double real-time fluorescent quantitative PCR detection primers and methods for Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV), in particular to multiple SYBR Green II real-time fluorescent quantitative PCR methods for MDPV and GPV Primers and methods. Background technique [0002] Muscovy duck parvovirus (MDPV) is the pathogen that causes muscovy duck blight (commonly known as "three-week disease") with diarrhea, soft feet and dyspnea as the main symptoms in young muscovy ducks. The incidence of Muscovy ducks is 27% to 62%, and the fatality rate is 22% to 43%. It is an important pathogen that endangers Muscovy duck breeding. The disease was first isolated and identified in the world by Cheng Youquan, a Chinese scholar, in 1988, and then France, the United States, Japan and other places reported the prevalence of the disease one after another. [0003] Gos...

AI Technical Summary

Problems solved by technology

However, due to the new gene subtype GPV (MDGPV) popular in Muscovy duck populations in my country in recent years, which has high homology with classic GPV and MDPV, it is often misidentified when using the existing dual fluorescent quantitative PCR method. MDPV

At present, there is no set of dual fluorescence quantitative PCR detection primers and methods that can completely distinguish various genotypes of GPV from MDPV at the same time. The establishment of the present invention can fill in the gaps in related fields

Images