Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

47results about How to "Reliable detection means" patented technology

Subway shield tunnel lining quality high-precision rapid vehicle detection method and apparatus

ActiveCN108828589AMeet high-speed detectionAccurately determine the type of diseaseRadio wave reradiation/reflectionDiseaseVehicle detection
The invention discloses a subway shield tunnel lining quality high-precision rapid vehicle detection method and apparatus. The detection apparatus comprises an image acquisition module, a ground-penetrating radar module, a multi-sensor fusion positioning module, a laser range-finding module and an industrial personal computer, the image acquisition module comprises a linear array CCD industrial camera and an LED light source, the ground-penetrating radar module comprises a ground-penetrating radar antenna and a ground-penetrating radar host, and the multi-sensor fusion positioning module comprises an inertia measuring apparatus and an encoder. The method and apparatus can be used for automation and normalization detection of the shield tunnel lining quality of existed subway lines, the power failure operation is avoided, a maintenance skylight is not occupied, normal operation of the subway is not influenced, the detection efficiency is substantially improved, the detection time of disease types and positions is greatly shortened, the damage to the tunnel lining can be eliminated in time, and the safety operation of the subway and the life and property safety of people are guaranteed.
Owner:XI AN JIAOTONG UNIV

Direction diagnosing system of grounded fault of small current grounded distribution system

The invention discloses a direction diagnosing system of grounded fault of a small current grounded distribution system, which adopts a high voltage electric display HS connected on a switch to replace a zero sequence voltage transformer PT to detect a capacitive voltage U. For the small current grounded distribution system, based on the capacitive voltage U, when one-phase ground fault occurs at the load side, the zero sequence current I0 leads the capacitive voltage U with the leading angle theta2 being 0-180 degrees; when single-phase ground fault occurs at the power supply side, the zero sequence current I0 lags behind the capacitive voltage U with the lag angle theta1 being 0-90 degrees. Therefore, by extraction and treatment of steady component of ground fault of a feed line, the capacitive voltage U and zero sequence current I0 when the system faults is further detected to judge the direction of one-phase ground fault. The ground fault direction signal picked up by the ground fault direction diagnosing system provided by the invention can inform a controller of a power distribution station so that the controller acts correspondingly to the benefit of protecting the power distribution system.
Owner:BEIHANG UNIV +1

Fluorescent whitening agent detector and detection method thereof

The invention discloses a fluorescent whitening agent detector which comprises a detector body, and a display screen and a fluorescent detection module are arranged on the upper surface of the detector body, and the fluorescence detection module comprises a detection main body and a detection cell. The invention also discloses a detection method of the fluorescent whitening agent detector, which comprises the steps of putting to-be-detected samples into the detection cell, then arranging into the detection main body, detecting and reading. The fluorescent whitening agent in products is subjected to quantitative detection by means of the detector disclosed by the invention in a quick, accurate and easily portable manner on the spot; the detection method of the detector is simple, fast and accurate.
Owner:CHANGCHUN MATTEL INSTR

Method for measuring residual quantity of organic chloride pesticides in traditional Chinese medicinal materials

The invention provides a method for measuring residual quantity of organic chloride pesticides in traditional Chinese medicinal materials. A GPC-SPE-GC method is established, and the residual quantity of seventeen organic chloride pesticides in traditional Chinese medicinal materials is detected. The method comprises the following steps: extracting, performing preliminary GPC purification, performing solid phase extraction and binary purification, namely combining 200mg / 3mL of aminopropyl column NH2SPE and 250mg / 3mL of graphitized carbon black column GCB SPE, and sequentially purifying; and eluting according to a volume ratio of 8:2 of normal hexane to acetone solution. Compared with a traditional concentrated sulfuric acid purification method, the method disclosed by the invention has high sensitivity and safety, provides reliable detection means for safety production of traditional Chinese medicinal materials in China and safety supervision of exported foods and drugs and is worthy of popularization and application.
Owner:INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Method for detecting non-anode effect CF4

InactiveCN102495006AAchieve quantitative analysis of non-anodic effect CF <sub>4</sub> the goal ofReliable detection meansColor/spectral properties measurementsPhysicsSpectral analysis
The invention discloses a method for detecting non-anode effect CF4, which comprises a sampling point which is obtained by sampling electrolytic tank flue gas on a gas pipe of the electrolytic tank, a tank cover plate of the electrolytic tank is kept in a sealed state, the gas collection efficiency of the flue gas in the electrolytic tank is not less than 90%, a detection device spectral analysis sensitizing zone is corrected, therefore the volume concentration of the CF4 spectral analysis sensitizing zone is in 0-1ppmv scope; the dust in flue gas is removed before the flue gas is introduced in the detection device, a drying agent is used for absorbing the moisture in flue gas; the detection device is started, the zero point of the device is calibrated, and the flue gas flux in the detection device is regulated, voltage change and anodic current density change of the electrolytic tank are monitored, when the voltage of the electrolytic tank exceeds normal operation voltage by 50 millivolts or anodic current density exceeds normal operation current density by 0.5A / cm<2>, the detection is started, and the volume concentration of CF4 is recorded. The method of the invention can detect the non-anode effect CF4 with extreme low concentration and reach the purpose of quantitative analysis of the non-anode effect CF4.
Owner:GUIZHOU BRANCH CHINA ALUMINUM IND

Method for simultaneously measuring content of three antitubercular agents in blood and tissues

The invention provides a method for simultaneously measuring content of three antitubercular agents (retozide, rifampicin and pyrazinamide) in blood and tissues. The method has the characteristics of simplicity and convenience in operation, high precision, high detection speed, stability and reliability. A high-efficient liquid-phase chromatographic instrument (LC2010C), a column temperature control box AT-130 and an Lc-solution spectrum work station of the Japan Shimadzu Company are adopted. The chromatographic column is an analysis column and adopts a C8 column, the protection column adopts a C18 column, and the fluid phase adopts sodium 1-heptanesulfonate solution to prepare.
Owner:蒋晖 +2

Detection method for instrument constant test by adopting standard meter method

The invention provides a detection method for an instrument constant test by adopting a standard meter method. The detection method comprises the following steps of connecting a standard meter with adetected electric energy meter, applying reference voltage of the detected electric energy meter to the standard meter, and reading current forward active total electric energy of the detected electric energy meter as an initial electric energy value, applying the maximum current of the detected electric energy meter to the standard meter, setting a phase angle to be 0 degree, and starting the test after the power output of the standard meter is stable, accumulating the electric energy value of the standard meter, and when the accumulated electric energy value of the standard meter is within apreset range, adjusting the phase angle according to a preset phase shift angle, continuing to accumulate the electric energy value of the standard meter, and when the accumulated electric energy value of the standard meter is not less than a preset standard travel threshold, reading the current forward active total electric energy of the detected electric energy meter as a termination electric energy value, calculating the difference between the final electric energy value and the initial electric energy value of the detected electric energy meter, and calculating the error gamma of the detected electric energy meter, and judging qualification if gamma does not exceed the basic error limit, or otherwise, judging disqualification.
Owner:ZHENGZHOU WONDER ELECTRICAL POWER

Method for detecting three kinds of flavonoid constituents in seedless roxburgh rose fruits simultaneously

The invention discloses a method for detecting three kinds of flavonoid constituents in seedless roxburgh rose fruits simultaneously. The method comprises the steps that seedless roxburgh rose fruit dry powder to be detected is obtained, methyl alcohol or water-containing methyl alcohol is used for extraction, filtrate decompression and rotary drying are carried out, ultrapure water is added, normal butanol is saturated with water, extraction is carried out two times according to the ethanol and water ratio of 4:1, then, extraction is carried out two times through ethyl acetate, filtrates are combined and subjected to decompression and rotary drying, the volume is made constant, and a test solution is prepared; rutin, quercetin and kaempferol are selected as comparison products for preparing a comparison solution; the comparison solution and the test solution are sample and analyzed in a high performance liquid chromatograph under the same chromatographic condition, and the three kinds of flavonoid constituents in seedless roxburgh rose fruits are monitored according an external standard method. The main flavonoid constituents in seedless roxburgh rose fruits are detected for the first time under the same chromatographic condition, three specific compounds are identified, and the method can be more comprehensively and accurately used for intensive study of flavonoid active constituents in seedless roxburgh rose fruits.
Owner:GUIZHOU NORMAL UNIVERSITY

Beta2-MG chemiluminescence immunoassay kit and preparation method therefor

The invention discloses a beta2-MG chemiluminescence immunoassay kit and a preparation method therefor, belongs to the technical field of the immunoassay, and solves the problems of low technique sensitivity and high cost of the prior art. The kit comprises the following reagents: R1: the liquid containing streptavidin-coated magnetic beads; R2: the liquid containing the acridinium ester-labeled beta2-MG antibody; and R3: the liquid containing the biotin-labeled beta2-MG antibody. The beta2-MG chemiluminescence immunoassay kit of the invention has the advantages of high detection sensitivity,strong specificity, good repeatability, wide detection range and good stability, and can be widely used for clinical detection of the beta2-MG.
Owner:DIRUI MEDICAL TECH CO LTD

Method for rapidly detecting alarm link failure in IP (internal protocol)-RAN (random access network) equipment

The invention relates to a method for rapidly detecting alarm link failure in IP (internal protocol)-RAN (random access network) equipment. The method comprises the steps of: making a quick alarming link detecting protocol including a request message (request) and a reply message (replay); periodically sending the request message (request) to a main control unit through the business interface unit of the IP-RAN equipment; and if the business interface unit receives the reply message (replay) and can correctly fetch field information from the reply message (replay), determining that the link for the message transmission is correct based on physics and logic; otherwise, determining the link as the chain in an abnormal state. By using the method provided by the invention, the defects that the alarming is out of work because the alarming can not be normally transmitted due to abnormal link are prevented during researching, developing, producing, managing and maintaining IP-RAN equipment; and a mechanism for quickly detecting the alarming link fault between boards is provided to achieve efficient, reliable and flexible alarming link detecting means, which has important implications for ensuring the stability of the business.
Owner:FENGHUO COMM SCI & TECH CO LTD

Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer

The invention provides a muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer and method. The MDPV primer sequence is as follows: anupstream primer P1: TAATGGTGGCAGGAATGCACAGTTC, and a downstream primer P2: TGTTACCATGATGTCTGAAAT; the GPV primer sequence is as follows: an upstream primer P3: GAGGTAGACAGCAACAGAAA, and a downstream primer P4: GCTCGTCCGTGACCATA. Relevant research reports and invention patents about the dual real-time fluorescence quantitative PCR detection primer and method based on SYBR Green II capable of completely distinguishing all gene subtypes of GPV from MDPV are unavailable at present; the MDPV and GPV dual real-time fluorescence quantitative PCR detection primer and method provided by the invention appear for the first time in the relevant fields.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Method for determining chloramphenicol in freshwater pond sediment by applying liquid chromatograph/mass spectrometer

The invention relates to a method for determining chloramphenicol in freshwater pond sediment by applying a liquid chromatograph / mass spectrometer. The method comprises the following steps of firstly, collecting a sediment sample of an aquaculture pond; secondly, extracting the sample; thirdly, purifying with n-hexane; fourthly, extracting water saturated ethyl acetate solution; fifthly, blowing extracting solution to be dry with nitrogen gas, and dissolving the dry extracting solution with acetonitrile-water (5+95) to obtain standby solution; sixthly, performing solid phase extraction column for eluting; seventhly, extracting the water saturated ethyl acetate solution, and blowing dry with the nitrogen gas; eightly, dissolving methanol water (50+50), whirling, filtering by a microfiltration membrane of 0.22[mu]m and determining by using the liquid chromatograph / mass spectrometer. According to the method disclosed by the invention, by pretreatment for the freshwater pond sediment, a matrix disturbing substance is removed, the sensitivity is improved, and the pretreatment process is optimized; in addition, the sample is prevented from being derivaed, so that the operation step is simplified; a reliable detection means can be provided for checking a pollution source and evaluating the influence of the ecological environment on healthy breeding.
Owner:农业部渔业环境及水产品质量监督检验测试中心(天津)

Pollutant interface reaction electrochemical infrared spectrum combined in-situ characterization method and pollutant interface reaction electrochemical infrared spectrum combined in-situ characterization device

The invention relates to a pollutant interface reaction electrochemical infrared spectroscopy combined in-situ characterization method and device. The electrochemical infrared spectrum combined detection method constructed by the invention can obtain synchronous qualitative / quantitative, macroscopic / microcosmic and other multi-dimensional information of a target reaction, so that the pollutant reaction is more comprehensively understood, the multi-dimensional clarification of a pollutant interface process and a regulation and control mechanism is facilitated, and the pollution problem is effectively solved. The electrochemical infrared spectrum combination device established by the invention is relatively simple to operate, long in service life, relatively wide in infrared wave number application range and relatively multiple in application, and can be widely applied to in-situ characterization of pollutant interface reaction.
Owner:HUAZHONG NORMAL UNIV

Pediococcus pentosaceus strain P9-5, and screening identification and application thereof

InactiveCN104946558AScreening method for reasonable antagonistic lactic acid bacteria strainsScreening method for effectively antagonizing lactic acid bacteria strainsBacteriaMicrobiological testing/measurementQuarantinePediococcus species
The invention discloses a Pediococcus pentosaceus strain which is collected by China General Microbiological Culture Collection Center, and the collection number is CGMCC No.10573. The invention also discloses application of the Pediococcus pentosaceus strain in resisting Listeria monocytogenes. Separation purification and screening of lactobacillus, and primary screening and rescreening of the Listeria monocytogenes strain are performed to obtain the safe and effective Listeria monocytogenes antagonistic strain. When being used in the stage with high tendency to contamination by the Listeria monocytogenes, the Listeria monocytogenes antagonistic strain can enhance the Listeria monocytogenes control level in food, provides a reliable and effective detection means for Listeria monocytogenes examination and quarantine inspection in import and export food, lowers the risk in imports and exports, and promotes the import and export trade and economic development.
Owner:孙军

Nucleic acid composition and reagent kit for detecting cardiovascular disease medication related genes based on nucleic acid mass-spectrometric technique, and detection method

ActiveCN111118145AReduce non-specific amplification problemsImprove matchMicrobiological testing/measurementDNA/RNA fragmentationMultiplexGenotype
The invention discloses a nucleic acid composition and reagent kit for detecting cardiovascular disease medication related genes based on a nucleic acid mass-spectrometric technique, and a detection method, and relates to the technical field of gene detection. The nucleic acid composition disclosed by the invention comprises an amplification primer set for performing multiplex PCR amplification oncardiovascular disease medication related genes, and an extension primer set for performing a single-base extension reaction. When the nucleic acid composition, the reagent kit or the detection method provided by the invention is used, 16-site genotypes of the cardiovascular disease medication related genes can be detected through the nucleic acid mass-spectrometric technique, the characteristicsthat the sensitivity is high, the specificity is high, the result is easy to recognize, the accuracy is increased and the operations are convenient are obtained, a more reliable detection means is provided for detection of the cardiovascular disease medication related genes, and more reasonable medication guidance is also provided for individualization medication of cardiovascular diseases.
Owner:WUHAN YZY MEDICAL SCI & TECH

Quantitative detection method of peanut oil adulteration based on multi-source spectral data fusion

ActiveCN104807803BComprehensive Internal Characteristic InformationComprehensively reflect internal feature informationRaman scatteringNon destructiveQuantitative model
The invention discloses a quantitative detection method for peanut oil adulteration based on multi-source spectral data fusion, which comprises the following steps: oil sample preparation; spectral collection: respectively collecting Raman spectrograms and near-infrared spectrograms of all adulterated oil samples; Data fusion: fused the preprocessed Raman spectrum and near-infrared spectrum to obtain a fusion spectrum; adulteration quantitative model establishment: extracted characteristic wavelengths from the fusion spectrum, and established peanut oil through a multivariate quantitative correction method Quantitative model of sample adulteration; model validation; analysis of test samples. The quantitative detection method of peanut oil adulteration based on multi-source spectral data fusion provided by the present invention performs data fusion of edible oil spectra of two spectra, which has good complementarity and can more comprehensively reflect the internal characteristic information of edible oil; The detection method is fast and convenient, efficient and non-destructive, without pretreatment, high accuracy and strong applicability.
Owner:WUHAN POLYTECHNIC UNIVERSITY

A method and system for non-destructive testing of photovoltaic cells based on inductive photothermal radiation

The invention discloses a photovoltaic cell non-destructive detection method and a photovoltaic cell non-destructive detection system based on induction photothermal radiation. According to the present invention, electromagnetic induction excitation is performed with an excitation coil, and the electricity, the magnetism, the light, the heat and other information of the photovoltaic cell and the assembly are subjected to high-speed and precision measurement in a completely non-contact manner; the attribute, the defect and the health degree of the photovoltaic cell and the assembly are subjected to subtle and quantitative evaluation by fusing machine learning and an artificial neural network algorithm, such that the disadvantages that the subtle defect cannot be detected, the in-service detection cannot be achieved, the detection is slow and the like in the existing contact type detection are solved; the performance, the defect type and the whole health degree of the photovoltaic cell are subjected to quantitative evaluation by comprehensively utilizing the multi-frequency impedance information, the optical radiation information and the thermal radiation information so as to provide the theory, the method and the technical support for the ordered operation of the photovoltaic cell industry chain; and the method can be used for the online diagnosis of the failure of the photovoltaic cell and the assembly installed in the photovoltaic power plant so as to substantially improve the detection efficiency and the safety of the photovoltaic cell and the assembly.
Owner:HUNAN UNIV

Ultrasonic automatic detection system for self-healing discharge of self-healing parallel capacitor and ultrasonic automatic detection method

The invention discloses an ultrasonic automatic detection system for self-healing discharge of a self-healing parallel capacitor and an ultrasonic automatic detection method. The method comprises thesteps of picking up an ultrasonic signal generated by the self-healing discharge by adopting an acoustic emission sensor; amplifying the weak ultrasonic signal of the self-healing discharge by using apre-amplifier, and performing analog filtering on the signal through a band-pass filtering module; transmitting the signal to an upper computer by using a high-resolution A / D acquisition board card;processing and identifying the ultrasonic signal by the upper computer; judging the number of self-healing discharge times of the capacitor to be detected, judging the current self-healing discharge detection stage of the self-healing parallel capacitor according to the direct-current power supply output voltage value acquired by the voltage sensor in real time; and finally giving a detection report. The method is safe, portable and easy to operate, the discharging process is judged by detecting the ultrasonic signal generated by self-healing discharge of the capacitor, the method is suitablefor self-healing discharging detection occasions of the self-healing parallel capacitor, and a reliable and accurate detection means is provided for the self-healing parallel capacitor for an alternating-current power system.
Owner:ZHEJIANG FANGYUAN ELECTRICAL EQUIP TESTING +1

A method for analyzing and detecting benzothiazole and its derivatives in the production process of dibenzothiazole disulfide

The invention belongs to the technical field of analysis of benzothiazole and its derivatives, and specifically discloses an analysis and detection method for benzothiazole and its derivatives in the production process of dibenzothiazole disulfide (DM). The treated high-purity silica gel C18 chromatographic column is separated, and the diode array detector is detected, and the external standard method is used to determine benzothiazole-2-sodium sulfinate, 2-mercaptobenzothiazole, The content of benzothiazole-2-ketone, benzothiazole, etc. is for the control analysis of the dibenzothiazole disulfide synthesis process, the judgment of the reaction end point, the study of the reaction mechanism, the accumulation of impurities in the process of mechanical application and the determination of the limit value, And mother liquor purification treatment, wastewater monitoring process to provide determination methods.
Owner:CHEM TECH ACAD OF SHANDONG PROVINCE

High performance liquid chromatography detection method for characteristic chromatograms of sophora flower raw medicinal materials and decoction pieces

The invention discloses a high performance liquid chromatography detection method for characteristic chromatograms of sophora flower raw medicinal materials and decoction pieces, and relates to the technical field of medicinal material detection. The method takes octadecylsilane chemically bonded silica as a filler, acetonitrile as a mobile phase A and a 0.1% phosphoric acid solution as a mobile phase B. The method comprises the following steps: step S1, gradient elution time is 0-28 minutes, the mobile phase A accounts for 10-18%, and the mobile phase B accounts for 90-82%; s2, gradient elution time is 28-48 min, the mobile phase A accounts for 18%-35%, and the mobile phase B accounts for 82%-65%; s3, carrying out gradient elution for 48 to 56 minutes, taking 35 to 50 percent of the mobile phase A and 65 to 50 percent of the mobile phase B; s4, gradient elution is carried out for 56-60 min, the mobile phase A accounts for 50%-10%, and the mobile phase B accounts for 50%-90%; and S5, gradient elution is carried out for 60-65 min, the mobile phase A accounts for 10%, and the mobile phase B accounts for 90%. The method effectively makes up the vacancy that no sophora flower raw medicinal material and decoction piece characteristic spectrum detection method exists in the country at present.
Owner:陕西孙思邈高新制药有限公司

Apparatus for detecting contact corona and arc-drawing of high voltage switch cabinet

The invention discloses a contact corona and arc detecting device of a high voltage switchgear, which comprises a detecting unit, a data analysis and processing unit, a displaying unit, a network communication unit and a power supply unit, wherein the detecting unit adopts a sensor to output switchgear contact and arc signals to the data analysis and processing unit, one part of input signals is output to the displaying unit to display the detecting results after the data analysis and processing unit analyzes and processes input signals, and the other part is output to the network communication unit, and the detecting data are sent to a host computer through networks, and the power supply unit is electrified by devices. The contact corona and arc detecting device solves the problem on howto detect contact and arc of a high voltage switchgear, has the function of remote monitor and control, can reliably and accurately send out alarming information in time, and can be widely used on on-line monitoring contact and arc of high-voltage switch apparatuses of various electric force.
Owner:山东惠工电气股份有限公司

A safety belt assembly capable of detecting buckled state

The invention discloses a safety belt assembly capable of detecting the buckled state, which comprises a pressure sensor arranged on a seat, a detection switch for an insertion state, a warning device and a warning controller, and the pressure sensor, the detection switch and the warning device are electrically connected It is connected to the alarm controller; it also includes a retractor and a main frame, and the two ends of the retractor are integrally rotatably installed on the main frame through a rotating shaft, and a secondary retracting coil spring is also arranged between the retractor and the main frame. The retracting direction of the secondary retracting coil spring is opposite to that of the retracting coil spring; the length of the reversely wound safety belt on the housing matches the minimum pull-out length of the seat belt when it is correctly buckled; There is a distance sensor arranged radially toward the housing, and the distance sensor is electrically connected to the warning controller. The invention has the advantages of reasonable combination design, accurate and reliable detection means, the ability to identify the false insertion state, and the advantages of improving driving safety and the like.
Owner:CHONGQING RADIO & TV UNIV

A detection method for instrument constant test using standard meter method

The invention provides a detection method for meter constant test by adopting the standard meter method, which includes connecting the standard meter with the electric energy meter under inspection; applying the reference voltage of the electric energy meter under inspection to the standard meter, and reading the current normal voltage The active total electric energy is used as the initial electric energy value; apply the maximum current of the tested electric energy meter to the standard meter, set the phase angle to 0°, and start the test after the power output of the standard meter is stable; accumulate the electric energy value of the standard meter, when When the accumulated electric energy value of the standard meter is within the preset range, adjust the phase angle according to the preset phase shift angle; continue to accumulate the electric energy value of the standard meter, and when the accumulated electric energy value of the standard meter is not less than the preset standard travel threshold, read the detected The current total forward active energy of the electric energy meter is used as the termination electric energy value; calculate the difference between the termination electric energy value and the initial electric energy value of the electric energy meter under inspection, and calculate the error γ of the electric energy meter under inspection; if the γ does not exceed the basic error limit, it is pass, otherwise fail.
Owner:ZHENGZHOU WONDER ELECTRICAL POWER

Adrenocorticotrophic hormone assay kit and preparation method thereof

InactiveCN109239369AAvoid bead agglutinationAvoid agglutination of magnetic beadsBiological testingBiotin-streptavidin complexMagnetite Nanoparticles
The invention discloses an adrenocorticotrophic hormone assay kit and a preparation method thereof, and belongs to the technical field of immunoassay. The problem that the test accuracy in the prior art is bad is solved. The kit comprises the following reagents: R1, suspension containing streptavidin-conjugated magnetic nanoparticles; R2, the suspension containing adrenocorticotrophic hormone marked by a chemoluminescence marker; R3, the susnepsion containing the adrenocorticotrophic hormone marked by biotin, and a calibration product and a quality control product. The adrenocorticotrophic hormone assay kit prepared by adopting the method disclosed by the invention has relatively high detection sensitivity, and is simple in operation, accurate and fat in quantitative detection, and can beextensively applied to the clinical detection of the adrenocorticotrophic hormone.
Owner:DIRUI MEDICAL TECH CO LTD

Fluorescent whitening agent detector and detection method

The invention discloses a fluorescent whitening agent detector which comprises a detector body, and a display screen and a fluorescent detection module are arranged on the upper surface of the detector body, and the fluorescence detection module comprises a detection main body and a detection cell. The invention also discloses a detection method of the fluorescent whitening agent detector, which comprises the steps of putting to-be-detected samples into the detection cell, then arranging into the detection main body, detecting and reading. The fluorescent whitening agent in products is subjected to quantitative detection by means of the detector disclosed by the invention in a quick, accurate and easily portable manner on the spot; the detection method of the detector is simple, fast and accurate.
Owner:CHANGCHUN MATTEL INSTR

A method for the determination of free and protonated nicotine content by ultra-high performance convergence chromatography

The invention discloses a method for determining the content of free state and protonated nicotine by ultra-high-efficiency convergence chromatography, which belongs to the technical field of chemical analysis and detection, and includes the preparation of standard nicotine solutions and the preparation of sample solutions to be tested, including the preparation of free state nicotine and protonated nicotine. The nicotine can be converted into nicotine, and then directly detected by an ultra-high performance convergence chromatograph for quantitative analysis, which can be applied to the simultaneous determination of free nicotine and protonated nicotine. The method has high sensitivity, good stability, simple operation, rapidity, low cost, environmental friendliness, and is easy to popularize and apply.
Owner:SHENZHEN BOTON FLAVORS & FRAGRANCES

A car safety warning system

The invention discloses an automobile safety warning system. The system comprises a pressure sensor used for detecting a riding state of a driver and passengers, a detection switch which is arranged in a lock catch of a safety belt and used for detecting an insertion state of a spring bolt, a warning device used for sending out a warning prompt, and a warning controller used for receiving a detection signal and sending the warning information according to the detection signal, the pressure sensor, the detection switch and the warning device are all electrically connected with the warning controller, the device further comprises a winder assembly, the winder assembly comprises a shell and a rotating shaft rotatably installed on the shell, a woven tape is wound on the rotating shaft, a detection feature object used for being detected is fixedly attached to the woven tape, the detection feature object is located in the middle of the woven tape, and a switch sensing device used for detecting whether the detection feature object passes or not is further arranged at an outlet of the shell and electrically connected with the warning controller. The device has advantages of being ingeniousin structural design, accurate and reliable in detection means, good in warning effect, beneficial to improving driving safety and the like.
Owner:重庆竹素教育科技有限公司

High performance liquid chromatography detection method for specific chromatogram of honey-fried licorice root decoction pieces

The invention discloses a high performance liquid chromatography detection method for specific chromatograms of honey-fried licorice root decoction pieces, and relates to the technical field of medicinal material detection. The detection method adopts acetonitrile as a mobile phase A and a 0.1% phosphoric acid solution as a mobile phase B, and comprises the following elution steps: step S1, gradient elution time is 0-9 min, the mobile phase A accounts for 19-22%, and the mobile phase B accounts for 81-78%; s2, gradient elution time is 9-18 min, the mobile phase A accounts for 22%-30%, and the mobile phase B accounts for 78%-70%; s3, gradient elution is carried out for 18-29 min, the mobile phase A accounts for 30%-66%, and the mobile phase B accounts for 70%-34%; s4, gradient elution is carried out for 29-33 min, the mobile phase A accounts for 66-19%, and the mobile phase B accounts for 34-81%; s5, gradient elution is carried out for 33-45 min, the mobile phase A accounts for 19%, and the mobile phase B accounts for 81%. The high performance liquid chromatography test method for the specific chromatogram of the honey-fried licorice root decoction piece makes up the vacancy that no test method for the specific chromatogram of the honey-fried licorice root decoction piece exists at present.
Owner:陕西孙思邈高新制药有限公司

Method for Determination of Chloramphenicol in Freshwater Pond Sediment Using LC-MS

InactiveCN104407085BSimple and fast operationStrong qualitative and quantitative abilityComponent separationEcological environmentFresh water organism
The invention relates to a method for determining chloramphenicol in freshwater pond sediment by applying a liquid chromatograph / mass spectrometer. The method comprises the following steps of firstly, collecting a sediment sample of an aquaculture pond; secondly, extracting the sample; thirdly, purifying with n-hexane; fourthly, extracting water saturated ethyl acetate solution; fifthly, blowing extracting solution to be dry with nitrogen gas, and dissolving the dry extracting solution with acetonitrile-water (5+95) to obtain standby solution; sixthly, performing solid phase extraction column for eluting; seventhly, extracting the water saturated ethyl acetate solution, and blowing dry with the nitrogen gas; eightly, dissolving methanol water (50+50), whirling, filtering by a microfiltration membrane of 0.22[mu]m and determining by using the liquid chromatograph / mass spectrometer. According to the method disclosed by the invention, by pretreatment for the freshwater pond sediment, a matrix disturbing substance is removed, the sensitivity is improved, and the pretreatment process is optimized; in addition, the sample is prevented from being derivaed, so that the operation step is simplified; a reliable detection means can be provided for checking a pollution source and evaluating the influence of the ecological environment on healthy breeding.
Owner:农业部渔业环境及水产品质量监督检验测试中心(天津)