46results about How to "Accurate detection means" patented technology

A ship loader level two-dimensional laser scanning radar automatic detecting system and a method relates to the automatic detecting technical field, wherein, the system comprises two sets of laser scanning devices, an industrial control main frame and an image pick-up device; each laser scanning device comprises a two-dimensional laser radar, a servomotor, a shaft coupling, a rotating main shaft, a limit and zero sensor, a bearing seat containing a bearing, a contracting brake device, a laser radar back support and an L-shaped mounting bottom plate; the image pick-up device comprises a pickup camera and a tripod head. By means of the realtime scanning of the two-dimensional laser radar, the invention collects related data of a ship cabin, a loading chute and material; meanwhile, the invention provides a device realizing realtime display of the status of the ship cabin, the loading chute and material stacking as well as corresponding detection and data processing method. The system realizes three-dimensional scanning of the ship loader and material by means of the two-dimensional laser scanning radar which is combined with the servo motor and a motion control card. In addition, the invention can realizes less than 200mm positioning error of hatchway position and less than 100mm surface topography identification error.

The invention discloses an adaptive zero-speed interval detection method for a pedestrian navigation system. According to a fixed threshold method, a zero-speed detection interval has the problems of false detection and missing detection under the walking condition with varying gait frequencies; by an adaptive threshold method, the relationship between a zero-speed interval detection threshold and the gait frequency of a pedestrian can be analyzed, so that the detection accuracy of a zero-speed interval is effectively improved. By carrying out a calibration experiment of a zero-speed point judging threshold under the condition with different gait frequencies, the functional relationship between a zero-speed detection threshold and the gait frequency is established, and the adaptive adjustment of the detection threshold and the accurate detection of a zero-speed point are achieved, so that the detection accuracy of the zero-speed interval is improved; by the adaptive zero-speed interval detection method, adaptive detection of the zero-speed interval can be achieved only by using output data of a gyroscope and three accelerometers in an inertial measurement unit, without needing to add or use other external sensors to assist the detection of the zero-speed interval, so that the detection method is simple and accurate.

The invention discloses an oxidative desulfurization method for rare earth polyacid and ionic liquid extraction catalysis fuel oil, belonging to the technical field of catalytic oxidative desulfurization of fuel oil. Fuel oil with high sulfur content is catalytically oxidized under a catalytic system consisting of rare earth polyoxometallate, an ionic liquid and hydrogen peroxide, so that a deep desulfurization effect is achieved at the normal temperature, and efficient cleaning and utilization of energy are realized. Moreover, a catalyst and the ionic liquid are not degraded after repeated circular reactions, so that the method is a successful desulfurization method. The catalyst used in the catalytic system has the advantages of easiness for preparing, accurate detection measure, short reaction time, high catalytic oxidation transformation ratio and easiness in recycling.

The invention discloses a detecting device for Brucella infection. The detecting device comprises a test strip; a Brucella antigen detection area and a Brucella antibody detection area are arranged on a chromatographic membrane of the test strip. According to the detection device, a Brucella antigen and a Brucella antibody in a sample can be detected simultaneously; various outer membrane proteins are applied in a combined manner, so that the occurrence of false positive results can be reduced effectively; a double-antigen sandwich method and a double-antibody sandwich method are adopted, so that the sensitivity and the specificity of detection can be higher than those obtained according to the conventional indirect method, and the rapid detection of brucellosis is realized; the problems of high interference, and high false positive result or false negative result occurrence rate caused by long detection period, poor specificity and low sensitivity in the conventional brucellosis detection process are solved.

The invention relates to the field of rapid detection of food safety and particularly relates to a preparation method and application of an electrochemical sensor based on a cobalt oxide/mesoporous carbon nanocomposite material and application of the electrochemical sensor in fast detection of nitrite content in a food. The preparation method of the electrochemical sensor comprises preparing a nanocomposite material carrying cobalt oxide particles and graphitized mesoporous carbon, and modifying a work electrode of the electrochemical sensor. The electrochemical sensor can detect a standard solution of nitrite, determine the linear relationship between the nitrite concentration and current, determine nitrite in the food and compare the nitrite content in the food and the linear relationship to obtain nitrite content of the food to be detected. The electrochemical sensor can determine nitrite content of a food, is easy to operate, has a fast detection rate and high detection sensitivity and provides a novel detection method for efficient and rapid detection of nitrite content in a food.

The invention relates to the technical field of molecular biology and medicine, in particular to PD-L1 targeting polypeptide as well as a preparation method and application thereof. The invention provides a PD-L1 targeting polypeptide. The general formula of the PD-L1 targeting polypeptide is X15X14X13X12X11X10X9X8X7X6X5X4X3X2X1, NX5X4X3EX2X1 or X8YX7X6TX5X4X3X2X1. The PD-L1 targeting polypeptideprovided by the invention has relatively high affinity and specificity to PD-L1, can specifically and efficiently target PD-L1 positive tumor cells, and can be used as a small molecular probe for detecting PD-L1 expression in tumor cells in practice or used as a targeting polypeptide to be conjugated or mixed with a preparation capable of killing cancer cells. The polypeptide is used for targetedtherapy and imaging of various tumors, and has a wide application prospect.

The invention provides an African swine fever virus nucleic acid rapid detection method and kit, and belongs to the technical field of biology. The kit provides specific RPA labeled primers ASF-F and ASF-R for detecting nucleic acid of the African swine fever virus, and the sequences of the specific RPA labeled primers ASF-F and ASF-R are shown as SEQ ID No.1 and SEQ ID No.2. The kit also provides a detection test strip which can be used for detecting RPA amplification products. The RPA primers are adopted to amplify sample DNA respectively, the amplification products are detected through the test strip, and whether the sample is infected with the African swine fever virus or not can be judged. The detection method established aiming at the nucleic acid of the African swine fever virus does not need special equipment, the reaction time is only 25 minutes, the sensitivity is up to 100 cp/microliter, no cross reaction exists in four common swine-origin viruses, and the specificity is high. The African swine fever virus nucleic acid rapid detection kit provides a simple and effective detection means for detecting the nucleic acid of the African swine fever virus, and is suitable for field detection.

The invention discloses primers and a reagent kit for rapidly detecting the specific vibrio parahemolyticus virulence plasmid pVA1 on site. The sequences of the primers are shown as SE ID NO:3-6. By the adoption of the primers, the specific vibrio parahemolyticus virulence plasmid pVA1 can be easily, conveniently, rapidly and visually detected, accuracy is high, specificity is good, detection time is short, and operation is easy and convenient.

The invention discloses a real-time fatigue driving detection method. The method comprises the following steps: 1, acquiring image data from a video shot by a camera; 2, according to the obtained image data, performing state recognition, including face recognition, and completing eye and mouth positioning and classification; 3, calculating various parameters, and forming a multi-parameter composite criterion; 4, performing fatigue detection: determining whether fatigue exists or not according to a multi-parameter composite criterion, and if not, turning to the step 1; and if so, giving an alarm. According to the technology of the invention, an SSD (Single Shot MultiBox Detector) network is mainly utilized to identify faces in video images and position and classify eyes and mouths, and thena PERCLOS method, blinking frequency, yawn frequency and the like are utilized as fatigue judgment standards. In view of the detection effect of the SSD network, the technology of the invention has higher detection accuracy and real-time performance.

The invention relates to the technical field of two-stage cone pulleys, and discloses a two-stage cone pulley phase angle error detecting device and a detecting method thereof. The device comprises ameasuring base, a two-stage cone pulley centering component, a pinion cogging positioning component and a large gear phase offset distance measuring component. The pinion cogging positioning componentis disposed at the pinion side of the two-stage cone pulley to be detected and radially positions the pinion cogging; the large gear phase offset distance measuring component is disposed on the largegear side of the two-stage cone pulley to measure the offset of the center position of a tooth socket being closet to the axis of the pinion cogging positioning component relative to the corresponding position of a two-stage cone pulley calibration component. The two-stage cone pulley phase angle error detecting device and the detecting method thereof employ the two-stage cone pulley centering component and the pinion cogging positioning component to locate the two-stage cone pulley to be detected to measure the deviation value to obtain an error value so as to greatly improve the detection efficiency of the two-stage cone pulley phase angle.

The invention discloses a preparation method of a straddle type monorail vehicle framework bottom plate pre-assembly. The preparation method comprises the following steps that (1) a forged piece is machined; (2) a bent plate and the machined forged piece are fixed to a welding tool through a pressing device, specifically, the welding tool is provided with a welding reversible deformation design, and the included angles between the forged piece and the horizontal plane and between the bent plate and the horizontal plane are 5 degrees; (3) during welding, welding seams between the bent plate and the forged piece are set as butt welding seams, specifically, each butt welding seam is completed in the mode that flat welding position welding is conducted firstly, then vertical welding position welding is conducted, and then flat welding position welding is conducted, and each butt welding seam needs to be welded continuously without arc stopping in the welding process; and (4) after welding is completed and complete cooling is achieved, the bottom plate pre-assembly is taken out for welding seam check, and shape adjustment after welding is not needed. The bottom plate pre-assembly product adopting a butt joint plays a positive role in promoting the welding seam strength, the welding quality and the production efficiency and reducing the cost.

The invention relates to a stapled peptide of a targeted tumor stem cell marker CD133 and an application of the stapled peptide, and belongs to the field of biomedical detection and medicinal chemistry. The polypeptide amino acid sequence SKDEEX1X2X3X4X5X6X7X8X9X10X11X12X13X14X15 is stapled, the resulting stapled peptide comprising two non-natural amino acids X which are crosslinked at i and i+n (n=3, 4, 5, 6, 7, 8, 9) positions by a linker forming a macrocycle. The stapled peptide disclosed by the invention can be used for generating in-situ induced self-assembly of the CD133 tumor stem cell marker. The stapled peptide provided by the invention is more stable in alpha-helical conformation and stronger in self-assembly capability to a certain extent, and the plasma stability is greatly enhanced. The stapled peptide disclosed by the invention can achieve a targeting effect on CD133 positive cells, and can be used as a targeting material for specifically targeting cancer cells.

According to the invention, Tan1 has four allele types in total, namely Tan1, tan 1-a, tan 1-b and tan 1-c. The invention discloses a method for identifying a sorghum tannin allelic variant gene Tan1.The primers Tan1-BZF1 and Tan1-BZR1 are used for amplifying a sorghum Tan1 gene part open reading frame, the sizes Tan1 and tan1-a of PCR product fragments are 257 bp, and the sizes of tan1-b and tan1-c products are 267 bp and 247 bp respectively; tan1-BZF2 and Tan1-BZR2 are used for amplifying a sorghum Tan1 gene part, and a reading frame is opened; compared with Tan1, Tan1-a has the advantagesthat 580-bit G of a reading frame is deleted, a new EcoN1 restriction enzyme cutting site is generated due to deletion, a 344bp band and a 454bp band are generated after PCR fragments are subjected toEcoN1 restriction enzyme cutting, and identification of Tan1 and Tan1-a is completed. The invention develops an efficient molecular marker, and provides a more perfect and accurate detection means for cultivating special sorghum materials for food and feed with low tannin content.

The invention discloses a primer for detecting porcine circovirus 3, a PCR (polymerase chain reaction) kit and an application. The sequence of an upstream primer of the primer is 5' CGGGAAATCTGACTGAAGTT 3', and the sequence of a downstream primer of the primer is 5' ACTCCTCCGGTACAACATTA 3'. The primer has the advantages that the primer is a pair of specific primers designed for PCV3 (porcine circovirus 3) according to the sequence of the PCV3 in a GenBank, a method for rapidly and accurately detecting the PCV3 is built, strong in specificity, high in sensitivity and good in repeatability, anda rapid and accurate detection means is provided for laboratory diagnosis of the PCV3 and survey of the prevalence state of the PCV3 in Chinese swine herds.

A method for detecting mononucleotide polymorphism by conformational difference gel electrophoresis. The method comprises the following specific steps: (1) collecting samples; (2) extracting DNA of a sample genome; (3) selecting single nucleotide polymorphisms (SNPs) associated with disease occurrence, drug efficacy and toxicity for a polymerase chain reaction (PCR ) amplification; (4) carrying out conformational difference gel electrophoresis analysis on PCR products, and determining different genotypes according to position and number of bands; and (5) carrying out DNA sequencing on PCR products of samples with different band types, and determining specific genotypes of different samples. According to the invention, the analysis of SNPs is analysis of double-stranded PCR products, without requiring endonuclease; samples can be loaded directly for gel electrophoresis without any prior processing; and no expensive equipment or reagent is required; therefore the method has advantages of simple operation and low cost. This invention provides a fast, accurate, simple, and low-cost detection means for SNPs related to disease susceptibility and individualized drug therapy, and lays foundation for clinical application of the method.