Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

46results about How to "Accurate detection means" patented technology

Method for targeted knockout of gene ALK6 by using CRISPR-Cas9

The invention discloses a method for targeted knockout of a gene ALK6 by using CRISPR-Cas9. The method comprises the steps of carrying out homologous comparison on a plurality of species so as to select two pairs of gene ALK6 target sequences, synthesizing DNA double strands, of which two pairs of target sequences are different and expressed proteins are the same and which have the same BsmBI cohesive ends, by using PAM design principles of gRNA, connecting the double strands with plasmid pPDNA330 so as to obtain recombinant vectors carrying ALK6 homologous genes of a plurality of species, detecting gene knockout efficiency of the recombinant vectors by using a fluorescin expression method, carrying out transfection on a vector with higher knockout efficiency with recipient cells of a plurality of species, and carrying out gene knockout and verification, thereby completing simple, efficient and accurate gene knockout of genes ALK6 of a plurality of species.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION BUFFALO INST

Method for knocking out MSTN (myostatin) genes in targeted manner by utilizing CRISPR-Cas9

The invention discloses a method for knocking out MSTN (myostatin) genes in a targeted manner by utilizing CRISPR-Cas9. According to the method, multiple species are subjected to homology comparison, two pairs of MSTN gene target sequences are selected, two pairs of DNA double strands which have the sequences different from the target sequences, the same expression protein and the same BsmBi sticky ends are synthesized according to the design principle of PAM of gRNA, the double strands are connected with pPDNA330 plasmids, a recombinant vector carrying MSTN homologous genes of multiple species is obtained and is used for detecting the gene knockout efficiency with a fluorescent protein expression method, carrier-transfected receptor cells, having higher knockout efficiency, of multiple species are selected, gene knockout and verification are performed, and simple, efficient and accurate gene knockout on the MSTN genes of the multiple species is completed.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION BUFFALO INST

System and method for automatically detecting shiploader article position two-dimension laser scanning radar

InactiveCN101206262ARealize 3D scanningAchieving Positioning ErrorElectromagnetic wave reradiationLaser scanningEngineering
A ship loader level two-dimensional laser scanning radar automatic detecting system and a method relates to the automatic detecting technical field, wherein, the system comprises two sets of laser scanning devices, an industrial control main frame and an image pick-up device; each laser scanning device comprises a two-dimensional laser radar, a servomotor, a shaft coupling, a rotating main shaft, a limit and zero sensor, a bearing seat containing a bearing, a contracting brake device, a laser radar back support and an L-shaped mounting bottom plate; the image pick-up device comprises a pickup camera and a tripod head. By means of the realtime scanning of the two-dimensional laser radar, the invention collects related data of a ship cabin, a loading chute and material; meanwhile, the invention provides a device realizing realtime display of the status of the ship cabin, the loading chute and material stacking as well as corresponding detection and data processing method. The system realizes three-dimensional scanning of the ship loader and material by means of the two-dimensional laser scanning radar which is combined with the servo motor and a motion control card. In addition, the invention can realizes less than 200mm positioning error of hatchway position and less than 100mm surface topography identification error.
Owner:SHANGHAI JIAO TONG UNIV

UPLC-MS/MS simultaneous flux detection method for multiclass veterinary drug residue in raw fresh milk

The invention discloses a UPLC-MS / MS simultaneous flux detection method for multiclass veterinary drug residue in raw fresh milk. The method includes the steps of: (1) extracting a veterinary drug compound in a to-be-detected sample to obtain an extracted solution; (2) concentrating the extracted solution, and then regulating the pH to 7.5-10.0 to obtain a column passing solution; (3) activating a solid phase extraction column; and (4) loading the column passing solution on the activated solid phase extraction column, leaching the solid phase extraction column with leacheate, then conducting elution with eluent, collecting the eluent, carrying out concentration, redissolving and filtration by a filter membrane, then performing qualitative and quantitative determination by UPLC-MS / MS. The method provided by the invention can simultaneously detect 38 veterinary drug residue in raw fresh milk, and has the characteristics of high sensitivity and low detection limit. The matrix standard curve correlation degree, the standard addition recovery rate of the method and the intra-day and inter-day precision are all accord with the China, European Union and international veterinary drug residue analysis method requirements. The method provided by the invention provides efficient and accurate detection means for raw fresh milk veterinary drug residue risk analysis and warning research.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI +1

Adaptive zero-speed interval detection method for pedestrian navigation system

The invention discloses an adaptive zero-speed interval detection method for a pedestrian navigation system. According to a fixed threshold method, a zero-speed detection interval has the problems of false detection and missing detection under the walking condition with varying gait frequencies; by an adaptive threshold method, the relationship between a zero-speed interval detection threshold and the gait frequency of a pedestrian can be analyzed, so that the detection accuracy of a zero-speed interval is effectively improved. By carrying out a calibration experiment of a zero-speed point judging threshold under the condition with different gait frequencies, the functional relationship between a zero-speed detection threshold and the gait frequency is established, and the adaptive adjustment of the detection threshold and the accurate detection of a zero-speed point are achieved, so that the detection accuracy of the zero-speed interval is improved; by the adaptive zero-speed interval detection method, adaptive detection of the zero-speed interval can be achieved only by using output data of a gyroscope and three accelerometers in an inertial measurement unit, without needing to add or use other external sensors to assist the detection of the zero-speed interval, so that the detection method is simple and accurate.
Owner:BEIJING INSTITUTE OF TECHNOLOGYGY

Oxidative desulfurization method for rare earth polyacid and ionic liquid extraction catalysis fuel oil

The invention discloses an oxidative desulfurization method for rare earth polyacid and ionic liquid extraction catalysis fuel oil, belonging to the technical field of catalytic oxidative desulfurization of fuel oil. Fuel oil with high sulfur content is catalytically oxidized under a catalytic system consisting of rare earth polyoxometallate, an ionic liquid and hydrogen peroxide, so that a deep desulfurization effect is achieved at the normal temperature, and efficient cleaning and utilization of energy are realized. Moreover, a catalyst and the ionic liquid are not degraded after repeated circular reactions, so that the method is a successful desulfurization method. The catalyst used in the catalytic system has the advantages of easiness for preparing, accurate detection measure, short reaction time, high catalytic oxidation transformation ratio and easiness in recycling.
Owner:BEIJING UNIV OF CHEM TECH

Direction diagnosing system of grounded fault of small current grounded distribution system

The invention discloses a direction diagnosing system of grounded fault of a small current grounded distribution system, which adopts a high voltage electric display HS connected on a switch to replace a zero sequence voltage transformer PT to detect a capacitive voltage U. For the small current grounded distribution system, based on the capacitive voltage U, when one-phase ground fault occurs at the load side, the zero sequence current I0 leads the capacitive voltage U with the leading angle theta2 being 0-180 degrees; when single-phase ground fault occurs at the power supply side, the zero sequence current I0 lags behind the capacitive voltage U with the lag angle theta1 being 0-90 degrees. Therefore, by extraction and treatment of steady component of ground fault of a feed line, the capacitive voltage U and zero sequence current I0 when the system faults is further detected to judge the direction of one-phase ground fault. The ground fault direction signal picked up by the ground fault direction diagnosing system provided by the invention can inform a controller of a power distribution station so that the controller acts correspondingly to the benefit of protecting the power distribution system.
Owner:BEIHANG UNIV +1

Processing method and processing apparatus for sequencing data

The present invention provides a processing method and processing apparatus for sequencing data. The processing method comprises: acquiring nucleotide sequence information originating from a maternal peripheral blood sample by means of high throughput sequencing; dividing a reference genome into a plurality of specific regions, wherein NRSc values in the specific regions are equal; allocating nucleotide sequence information originating from all chromosomes of the maternal peripheral blood sample to the plurality of specific regions of the reference genome, and collecting statistics of an NRSc value of the sample in each specific region; modifying the NRSc value of the sample in each specific region by using a GC content, and marking a modified NRSc value as an NRSs' value; based on the NRSs' value, separately collecting statistics of mean values of NRSs' values of all specific regions on a target chromosome and a contrast chromosome, and marking the mean values as a first mean value and a second mean value; and performing a difference check on the first mean value and the second mean value, and according to a difference check result, determining whether the chromosome has aneuploidy. The processing method improves accuracy of sequencing data processing.
Owner:GUANGZHOU RIBOBIO

Reaction system and kit for detecting African swine fever virus nucleic acid and application thereof

The invention relates to a reaction system for detecting African swine fever virus nucleic acid. The reaction system is an SHERLOCK reaction system. The system comprises an RPA primer pair for amplifying a target nucleic acid fragment and / or crRNA, the crRNA is used for combining ssRNA transcribed by the amplified target nucleic acid fragment, the primer pair comprises primers with sequences shownas SEQ ID NO.1 and SEQ ID NO.2, the crRNA is synthesized from crDNA, and the sequence of the crDNA is shown as SEQ ID NO.3. The system further comprises Cas13a, a fluorescence labeling probe and thelike, the Cas13a is combined with the crRNA combined with the ssRNA so as to have RNA enzyme activity, the Cas13a with the RNA enzyme activity cuts the fluorescence labeling probe to generate fluorescence, and the generated fluorescence can be detected in real time. The invention also relates to a kit comprising the reaction system and related application of the RPA primer pair and / or the crRNA. The kit and a detection method are used for detecting the African swine fever virus nucleic acid, can realize constant-temperature detection at 37 DEG C, have short reaction time, high detection speed,and high sensitivity and the specificity.
Owner:PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Detecting device for Brucella infection

The invention discloses a detecting device for Brucella infection. The detecting device comprises a test strip; a Brucella antigen detection area and a Brucella antibody detection area are arranged on a chromatographic membrane of the test strip. According to the detection device, a Brucella antigen and a Brucella antibody in a sample can be detected simultaneously; various outer membrane proteins are applied in a combined manner, so that the occurrence of false positive results can be reduced effectively; a double-antigen sandwich method and a double-antibody sandwich method are adopted, so that the sensitivity and the specificity of detection can be higher than those obtained according to the conventional indirect method, and the rapid detection of brucellosis is realized; the problems of high interference, and high false positive result or false negative result occurrence rate caused by long detection period, poor specificity and low sensitivity in the conventional brucellosis detection process are solved.
Owner:SOUTHERN MEDICAL UNIVERSITY

Preparation method and application of cobalt oxide/mesoporous carbon composite material electrochemical sensor

The invention relates to the field of rapid detection of food safety and particularly relates to a preparation method and application of an electrochemical sensor based on a cobalt oxide / mesoporous carbon nanocomposite material and application of the electrochemical sensor in fast detection of nitrite content in a food. The preparation method of the electrochemical sensor comprises preparing a nanocomposite material carrying cobalt oxide particles and graphitized mesoporous carbon, and modifying a work electrode of the electrochemical sensor. The electrochemical sensor can detect a standard solution of nitrite, determine the linear relationship between the nitrite concentration and current, determine nitrite in the food and compare the nitrite content in the food and the linear relationship to obtain nitrite content of the food to be detected. The electrochemical sensor can determine nitrite content of a food, is easy to operate, has a fast detection rate and high detection sensitivity and provides a novel detection method for efficient and rapid detection of nitrite content in a food.
Owner:SHANGHAI OCEAN UNIV

Intelligent water reducing agent tester

The invention discloses a device for rapidly and accurately determining the water reduction rate of a water reducing agent, rapidly judging the compatibility of additives and cement and confirming cement paste fluidity loss. The device comprises a base, test tubes, stirring motors, stirring shafts, stirring blades, a stirring mechanism fixing rack and a singlechip control part from bottom to top. The device changes detection indexes of a conventional experiment method; the cement grain resistance values in cement paste in different dispersion states is detected by sensors on the stirring shafts so as to express the fluidity of the cement paste; and with combination of the test tubes for experiments and a singlechip, an experiment process and data analysis are carried out synchronously, so that the purpose of rapid detection is achieved. The device has the advantages that the water reduction rate of the water reducing agent is rapidly and accurately tested, the compatibility of the additives and the cement can be rapidly judged, and the cement paste fluidity loss under the action of the water reducing agent are determined; and the three experiment processes are modularized and combined, so that the working efficiency is improved, the experiment material waste is reduced, and the cost is lowered.
Owner:CHANGSHA UNIVERSITY OF SCIENCE AND TECHNOLOGY

PD-L1 targeting polypeptide as well as preparation method and application thereof

The invention relates to the technical field of molecular biology and medicine, in particular to PD-L1 targeting polypeptide as well as a preparation method and application thereof. The invention provides a PD-L1 targeting polypeptide. The general formula of the PD-L1 targeting polypeptide is X15X14X13X12X11X10X9X8X7X6X5X4X3X2X1, NX5X4X3EX2X1 or X8YX7X6TX5X4X3X2X1. The PD-L1 targeting polypeptideprovided by the invention has relatively high affinity and specificity to PD-L1, can specifically and efficiently target PD-L1 positive tumor cells, and can be used as a small molecular probe for detecting PD-L1 expression in tumor cells in practice or used as a targeting polypeptide to be conjugated or mixed with a preparation capable of killing cancer cells. The polypeptide is used for targetedtherapy and imaging of various tumors, and has a wide application prospect.
Owner:THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA

African swine fever virus nucleic acid rapid detection kit and application

The invention provides an African swine fever virus nucleic acid rapid detection method and kit, and belongs to the technical field of biology. The kit provides specific RPA labeled primers ASF-F and ASF-R for detecting nucleic acid of the African swine fever virus, and the sequences of the specific RPA labeled primers ASF-F and ASF-R are shown as SEQ ID No.1 and SEQ ID No.2. The kit also provides a detection test strip which can be used for detecting RPA amplification products. The RPA primers are adopted to amplify sample DNA respectively, the amplification products are detected through the test strip, and whether the sample is infected with the African swine fever virus or not can be judged. The detection method established aiming at the nucleic acid of the African swine fever virus does not need special equipment, the reaction time is only 25 minutes, the sensitivity is up to 100 cp / microliter, no cross reaction exists in four common swine-origin viruses, and the specificity is high. The African swine fever virus nucleic acid rapid detection kit provides a simple and effective detection means for detecting the nucleic acid of the African swine fever virus, and is suitable for field detection.
Owner:HUAZHONG AGRI UNIV

Colloidal gold immunochromatograohic assay (GICA) method of aflatoxin B1 in rice

InactiveCN106990236AEasy to operateTimely test resultsMaterial analysisField testsLimit value
The invention discloses a colloidal gold immunochromatograohic assay (GICA) method of aflatoxin B1 (AFB1) in rice. The method comprises the following steps: reducing HAuCl4 aqueous solution with a reduction method to prepare colloidal gold and uniformly mixing the colloidal gold and anti-AFB1 monoclonal antibody, so as to obtain a gold-labeled monoclonal antibody serving as an analysis probe; respectively enveloping an AFB1-BSA conjugate of a detection line and goat-anti-mouse IgG of a quality control line on a nitrocellulose membrane and establishing a GICA system of AFB1; slowing dropping rice sample solution onto the analysis probe and observing the color change of the detection line and the quality control line, wherein both the detection line and the quality control line are red when the concentration of AFB1 in a sample is lower than a limiting value; only the quality control line is red when the concentration of AFB1 in the sample is higher than the limiting value. The GICA technology disclosed by the invention serves as a novel detection technology, an instrument is not needed, and the technology has the advantages that the operation is simple and fast, and a detection result is timely and accurate. Therefore, the technology is suitable for field test for AFB1 and has wide application prospect in the food safety testing field.
Owner:莆田方家铺子食品营养研究中心

Primers and reagent kit for rapidly detecting specific vibrio parahemolyticus virulence plasmid pVA1 on site

The invention discloses primers and a reagent kit for rapidly detecting the specific vibrio parahemolyticus virulence plasmid pVA1 on site. The sequences of the primers are shown as SE ID NO:3-6. By the adoption of the primers, the specific vibrio parahemolyticus virulence plasmid pVA1 can be easily, conveniently, rapidly and visually detected, accuracy is high, specificity is good, detection time is short, and operation is easy and convenient.
Owner:海峡两岸农产品检验检疫技术厦门中心

Real-time fatigue driving detection method

The invention discloses a real-time fatigue driving detection method. The method comprises the following steps: 1, acquiring image data from a video shot by a camera; 2, according to the obtained image data, performing state recognition, including face recognition, and completing eye and mouth positioning and classification; 3, calculating various parameters, and forming a multi-parameter composite criterion; 4, performing fatigue detection: determining whether fatigue exists or not according to a multi-parameter composite criterion, and if not, turning to the step 1; and if so, giving an alarm. According to the technology of the invention, an SSD (Single Shot MultiBox Detector) network is mainly utilized to identify faces in video images and position and classify eyes and mouths, and thena PERCLOS method, blinking frequency, yawn frequency and the like are utilized as fatigue judgment standards. In view of the detection effect of the SSD network, the technology of the invention has higher detection accuracy and real-time performance.
Owner:UNIV OF SCI & TECH OF CHINA

Two-stage cone pulley phase angle error detecting device and detecting method thereof

The invention relates to the technical field of two-stage cone pulleys, and discloses a two-stage cone pulley phase angle error detecting device and a detecting method thereof. The device comprises ameasuring base, a two-stage cone pulley centering component, a pinion cogging positioning component and a large gear phase offset distance measuring component. The pinion cogging positioning componentis disposed at the pinion side of the two-stage cone pulley to be detected and radially positions the pinion cogging; the large gear phase offset distance measuring component is disposed on the largegear side of the two-stage cone pulley to measure the offset of the center position of a tooth socket being closet to the axis of the pinion cogging positioning component relative to the corresponding position of a two-stage cone pulley calibration component. The two-stage cone pulley phase angle error detecting device and the detecting method thereof employ the two-stage cone pulley centering component and the pinion cogging positioning component to locate the two-stage cone pulley to be detected to measure the deviation value to obtain an error value so as to greatly improve the detection efficiency of the two-stage cone pulley phase angle.
Owner:DONGFENG MOTOR CO LTD

Primer pair, kit and method for rapidly detecting horse-derived components in horse hide and mule hide

The invention provides an RPA labeled primer pair, a kit and a method for quickly detecting horse-derived components in horse hide and mule hide, and belongs to the technical field of biology. The RPA labeled primer pair has sequences as shown in SEQ ID No. 1 and SEQ ID No. 2. The method includes: on the basis of naked eye preliminary identification, extracting DNA from DNA horse hide and mule hide that are suspected to be donkey hide, and amplifying by adopting the RPA labeled primer pair; detecting the RPA amplification product by using a detection test strip and judging a result. Whether a sample is horse hide or mule hide is identified by judging whether the sample contains horse-derived components or not, so that authenticity of the donkey hide is judged. The method for detecting the horse-derived components in horse hide and mule hide does not need special equipment, only needs 40 minutes of reaction time, has strong specificity, has advantages of simplicity, convenience, quickness and the like, provides an effective, accurate and reliable means for detecting the horse-derived components in the horse hide and mule hide, and is very suitable for detecting authenticity of donkey hide on site.
Owner:HUAZHONG AGRI UNIV

Preparation method of straddle type monorail vehicle framework bottom plate pre-assembly

The invention discloses a preparation method of a straddle type monorail vehicle framework bottom plate pre-assembly. The preparation method comprises the following steps that (1) a forged piece is machined; (2) a bent plate and the machined forged piece are fixed to a welding tool through a pressing device, specifically, the welding tool is provided with a welding reversible deformation design, and the included angles between the forged piece and the horizontal plane and between the bent plate and the horizontal plane are 5 degrees; (3) during welding, welding seams between the bent plate and the forged piece are set as butt welding seams, specifically, each butt welding seam is completed in the mode that flat welding position welding is conducted firstly, then vertical welding position welding is conducted, and then flat welding position welding is conducted, and each butt welding seam needs to be welded continuously without arc stopping in the welding process; and (4) after welding is completed and complete cooling is achieved, the bottom plate pre-assembly is taken out for welding seam check, and shape adjustment after welding is not needed. The bottom plate pre-assembly product adopting a butt joint plays a positive role in promoting the welding seam strength, the welding quality and the production efficiency and reducing the cost.
Owner:安徽雷尔伟交通装备有限公司

Fluorescent probe for detecting and quantifying signal molecule of Gram negative bacteria colony

The invention discloses a fluorescent probe for detecting and quantifying signal molecule of Gram negative bacteria colony, and belongs to the technical field of rapid detection of pathogenic bacterium. According to the fluorescent probe, a quantum dot is connected with MIP through a surface molecular imprinting technology, and the purpose of accurate quantitative detection is achieved through a fluorescence value on the basis of high degree specificity detection and fluorescence. MIP polymer is precipitated and polymerized on the surface of an amino-silane functional group modified by a CdSe / ZnS quantum dot in advance, so that QDs@MIP is successfully synthesized. The invention further discloses a preparation method and the application of the molecular imprinting fluorescent probe. The fluorescent probe can realize indirect detection of part of Gram negative bacteria, has the advantages of sensitivity, speediness and high specificity, and is low in price, and the method has an important implication for food safety or health care facilities, and can be applied to the direct monitoring of Gram negative bacteria.
Owner:JIANGNAN UNIV

Targeted tumor stem cell marker CD133 stapled peptide and application thereof

The invention relates to a stapled peptide of a targeted tumor stem cell marker CD133 and an application of the stapled peptide, and belongs to the field of biomedical detection and medicinal chemistry. The polypeptide amino acid sequence SKDEEX1X2X3X4X5X6X7X8X9X10X11X12X13X14X15 is stapled, the resulting stapled peptide comprising two non-natural amino acids X which are crosslinked at i and i+n (n=3, 4, 5, 6, 7, 8, 9) positions by a linker forming a macrocycle. The stapled peptide disclosed by the invention can be used for generating in-situ induced self-assembly of the CD133 tumor stem cell marker. The stapled peptide provided by the invention is more stable in alpha-helical conformation and stronger in self-assembly capability to a certain extent, and the plasma stability is greatly enhanced. The stapled peptide disclosed by the invention can achieve a targeting effect on CD133 positive cells, and can be used as a targeting material for specifically targeting cancer cells.
Owner:BEIJING INSTITUTE OF TECHNOLOGYGY

Primers for identifying molecular markers of sorghum tannin Tan1 allelic variant genes as well as identification method and an application of primers

According to the invention, Tan1 has four allele types in total, namely Tan1, tan 1-a, tan 1-b and tan 1-c. The invention discloses a method for identifying a sorghum tannin allelic variant gene Tan1.The primers Tan1-BZF1 and Tan1-BZR1 are used for amplifying a sorghum Tan1 gene part open reading frame, the sizes Tan1 and tan1-a of PCR product fragments are 257 bp, and the sizes of tan1-b and tan1-c products are 267 bp and 247 bp respectively; tan1-BZF2 and Tan1-BZR2 are used for amplifying a sorghum Tan1 gene part, and a reading frame is opened; compared with Tan1, Tan1-a has the advantagesthat 580-bit G of a reading frame is deleted, a new EcoN1 restriction enzyme cutting site is generated due to deletion, a 344bp band and a 454bp band are generated after PCR fragments are subjected toEcoN1 restriction enzyme cutting, and identification of Tan1 and Tan1-a is completed. The invention develops an efficient molecular marker, and provides a more perfect and accurate detection means for cultivating special sorghum materials for food and feed with low tannin content.
Owner:LIAONING ACAD OF AGRI SCI

Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application

The invention discloses a primer for detecting porcine circovirus 3, a PCR (polymerase chain reaction) kit and an application. The sequence of an upstream primer of the primer is 5' CGGGAAATCTGACTGAAGTT 3', and the sequence of a downstream primer of the primer is 5' ACTCCTCCGGTACAACATTA 3'. The primer has the advantages that the primer is a pair of specific primers designed for PCV3 (porcine circovirus 3) according to the sequence of the PCV3 in a GenBank, a method for rapidly and accurately detecting the PCV3 is built, strong in specificity, high in sensitivity and good in repeatability, anda rapid and accurate detection means is provided for laboratory diagnosis of the PCV3 and survey of the prevalence state of the PCV3 in Chinese swine herds.
Owner:SHANDONG NEW HOPE LIUHE GROUP

Heart-type fatty acid binding protein content detection kit and preparation method thereof

The invention discloses a heart-type fatty acid binding protein content detection kit and a preparation method thereof. The kit disclosed by the invention is formed by a reagent I and a reagent II which are mutually independent; the reagent I comprises the following components of: a biological buffering agent, a surfactant, a coagulation accelerator, a preservative, a stabilizing agent, a blocking agent, a chelating agent and water; the reagent II comprises the following components of: latex grains covered by a heart-type fatty acid binding protein antibody, a biological buffering agent, a chelating agent, a surfactant, a preservative, a suspending aid, a sealing agent, a stabilizing agent and water; and the grain diameters of the latex grains covered by the heart-type fatty acid binding protein antibody are within 90-200nm. The detection kit disclosed by the invention has a series of advantages of good stability, strong specificity, high sensitivity, strong anti-interference capability on rheumatoid factors, good linear range, simplicity and convenience for detection and operation and the like, and is good for large-scale popularization and application.
Owner:WUHAN LIFE ORIGIN BIOTECH LTD

Method for detecting mononucleotide polymorphism by conformational difference gel electrophoresis

A method for detecting mononucleotide polymorphism by conformational difference gel electrophoresis. The method comprises the following specific steps: (1) collecting samples; (2) extracting DNA of a sample genome; (3) selecting single nucleotide polymorphisms (SNPs) associated with disease occurrence, drug efficacy and toxicity for a polymerase chain reaction (PCR ) amplification; (4) carrying out conformational difference gel electrophoresis analysis on PCR products, and determining different genotypes according to position and number of bands; and (5) carrying out DNA sequencing on PCR products of samples with different band types, and determining specific genotypes of different samples. According to the invention, the analysis of SNPs is analysis of double-stranded PCR products, without requiring endonuclease; samples can be loaded directly for gel electrophoresis without any prior processing; and no expensive equipment or reagent is required; therefore the method has advantages of simple operation and low cost. This invention provides a fast, accurate, simple, and low-cost detection means for SNPs related to disease susceptibility and individualized drug therapy, and lays foundation for clinical application of the method.
Owner:NANCHANG UNIV

A method for oxidative desulfurization of catalytic fuel oil using multi-acid intercalation trimethylol hydrotalcite and ionic liquid extraction

The invention discloses a method for oxidative desulfurization of fuel oil by adopting polyacid intercalation trihydroxymethyl hydrotalcite and ionic liquid extraction catalysis. According to the method, high-sulfur fuel oil is subjected to catalytic oxidation in a catalytic system with combined use of polyacid intercalation trihydroxymethyl hydrotalcite, ionic liquid and oxydol, an effect of deep desulfurization is achieved under a mild condition, and efficient and clean utilization of an energy source is realized. The trihydroxymethyl hydrotalcite is used as a carrier, and the catalytic performance of polyacid can be greatly improved by using the characteristics of large surface area and limited range space of the carrier; a polyacid intercalation hydrotalcite composite material of the type not only has functional characteristics of anionic clay and polyacid ions, but also has a practical significance for solving the problem of immobilization of heteropolyacid during industrial catalysis; and meanwhile, the intercalation hydrotalcite composite material has a meso-microporous structure, and is very suitable for selective catalytic reaction. Moreover, a catalyst and the ionic liquid cannot be degraded after multiple times of cyclic reaction, so that the method is a relatively successful desulfurization method.
Owner:BEIJING UNIV OF CHEM TECH

Multiplex fluorescent quantitative PCR method for detecting and identifying three food-borne pathogenic bacteria

The invention discloses a multiplex fluorescent quantitative PCR method for detecting and identifying three food-borne pathogenic bacteria, and belongs to the technical field of microbial detection. The invention discloses multiplex fluorescent quantitative PCR amplification primers and probes for detecting and identifying three food-borne pathogenic bacteria, wherein the primers and probes comprise the following sequences: a primer pair and a probe for amplifying an escherichia coli O157:H7rfbE gene as shown in SEQ ID NO:1-3; a primer pair and a probe for amplifying a salmonella invA gene as shown in SEQ ID NO:4-6; and a primer pair and a probe for amplifying a listeria monocytogenes hlyA gene as shown in SEQ ID NO: 7-9; and the sequences as shown in SEQ ID NO:1-9 are used together in one detection. The multiplex fluorescent quantitative PCR method disclosed by the invention can provide methods and data support for accurate and rapid detection of three food-borne pathogenic bacteria including escherichia coli O157: H7, salmonella and listeria monocytogenes in food.
Owner:河北省畜牧兽医研究所 +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products