48results about How to "Rapid detection means" patented technology

The invention relates to the field of rapid detection of food safety and particularly relates to a preparation method and application of an electrochemical sensor based on a cobalt oxide/mesoporous carbon nanocomposite material and application of the electrochemical sensor in fast detection of nitrite content in a food. The preparation method of the electrochemical sensor comprises preparing a nanocomposite material carrying cobalt oxide particles and graphitized mesoporous carbon, and modifying a work electrode of the electrochemical sensor. The electrochemical sensor can detect a standard solution of nitrite, determine the linear relationship between the nitrite concentration and current, determine nitrite in the food and compare the nitrite content in the food and the linear relationship to obtain nitrite content of the food to be detected. The electrochemical sensor can determine nitrite content of a food, is easy to operate, has a fast detection rate and high detection sensitivity and provides a novel detection method for efficient and rapid detection of nitrite content in a food.

The invention discloses an application of EETs, sEH and sEH inhibitors in chronic heart failure, and belongs to the field of diagnosis, prevention and treatment of cardiovascular diseases. Two novel biomarkers-EETs and sEH are found, the effect of the biomarkers-EETs and sEH in the diagnosis of biomarkers in the chronic heart failure is proved as well as the effect of the biomarkers-EETs and sEH as a drug target in preventing, alleviating and/or improving the chronic heart failure; therefore, by detecting the EETs and sEH levels, the EETs and the sEH can predict and assist in the diagnosis ofthe chronic heart failure or assess the prognosis of the chronic heart failure; and meanwhile, the EETs level is controlled through drugs, diseases can be subjected to more intensive diagnosis and follow-up treatment, thus the EETs and the sEH haves huge application value in clinical practice.

The invention relates to the technical field of biology, and in particular relates to a kit for combined detection of 6 diabetic antibodies. The kit is used for combined detection of 6 antibodies such as ICA, GADA, IAA, IA-2ACPH-A and ZnT8-A in T1DM, T2DM and serum of a normal person, has high sensitivity (98 percent) and specificity (99.6 percent) for I type diabetic diagnosis, and provides efficient and fast detection means for classificatory diagnosis of diabetes.

The invention relates to the technical field of biology, in particular to a homocysteine detection kit and a preparation method thereof. According to the method, the traditional colloidal gold is replaced by novel fluorochrome quantum dot, and homocysteine in human serum can be accurately, quantitatively, rapidly and sensitively detected. The instrument required by the kit is different from the previous large expensive instrument in a clinical laboratory, only a small fluorescence quantitative analyzer is required, and real-time detection is realized.

The invention belongs to the technical field of medical science and discloses a method for genetic testing in single cells by HRM (high resolution melting) and pyrosequencing. By high-throughput sequencing for haplotype analysis of a single-gene inheritance disease family, an analysis method for mutation detection and SNP (single nucleotide polymorphism) by adoption of a single-cell whole genome amplification product as a template on the basis of HRM and pyrosequencing is established. The method can be applied clinically directly to provide fast detection means for PGD (preimplantation genetic diagnosis) diagnosis of patients suffering from single gene inheritance diseases.

The present invention discloses an X-ray detection technology-based three-dimensional tomographic reconstruction and slice display method. The method comprises the following steps that: (1) X-rays are adopted to scan a detected object, the X-ray projection data of the detected object are obtained; (2) image calibration and image processing are performed on the X-ray projection data; (3) three-dimensional tomographic reconstruction is performed on the X-ray projection data which have been subjected to the image calibration and image processing; and (4) three-dimensional image slice display is performed according to a three-dimensional tomographic reconstruction result. The method of the invention has the advantages of simple steps and convenient operation. With the method adopted, the internal structure and state of equipment can be reproduced realistically in a three-dimension mode with obtained limited data, and inspectors can be facilitated to directly observe and analyze the state of the equipment.

The invention belongs to the field of bacterial drug-resistant molecular detection, and relates to a multiple real-time fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni. The method is characterized in that an idiocratic primer, MGB probe, and combination of both are designed, not only is the specificity identification performed for the Campylobacter jejuni, but also the mutation of nucleotide of 2074th and 2075th of the 23S rRNA gene of Campylobacter jejuni and that of nucleotide of 170th and 221st of L4 flagellum gene rp1D of ribosome protein can be detected at the same time. The quick detection for drug-resistant mutation points of the various macrolides and the specificity identify for the Campylobacter jejuni are realized, which is first realized in the same reaction system, so that the identification and drug tolerance detection for the Campylobacter jejuni in clinical trials is greatly reduced, and as a result, a novel method is provided for Campylobacter jejuni drug-resistant monitoring and medicines for clinical trials infection treatment.

The invention discloses a polymerase chain reaction (PCR) primer pair for identifying an H9 subtype avian influenza virus (AIV) and application thereof. The PCR primer pair disclosed by the invention is composed of two single chain deoxyribonucleic acids (DNAs), wherein the two single chain DNAs are single chain DNAs shown in SEQ ID NO:1 and SEQ ID NO:2 in a sequence table. The HA gene of the H9 subtype AIV in a sample can be subjected to specific amplification, and the length of a target segment is 425bp. The method is free of cross reaction on H3, H4, H5 and other subtype AIVs, and a newcastle disease virus, avian infectious bronchitis, an infectious bursal disease virus, an infectious laryngotracheitis virus and the like; the minimum detectable quantity of virus allantoic fluid is 1*10<4.25>EID50/100mu L. Compared with the conventional methods such as a hemagglutination inhibition test of the virus and the like, the accordance rate of the identification result is 100%. A rapid, specific and sensitive detection means is provided for identification of the H9 subtype AIV. The PCR primer pair can be applied to rapid diagnosis of a disease caused by the H9 subtype AIV, and has a good application prospect in the aspects of clinical diagnosis and epidemiological investigation.

The invention provides an African swine fever virus nucleic acid rapid detection method and kit, and belongs to the technical field of biology. The kit provides specific RPA labeled primers ASF-F and ASF-R for detecting nucleic acid of the African swine fever virus, and the sequences of the specific RPA labeled primers ASF-F and ASF-R are shown as SEQ ID No.1 and SEQ ID No.2. The kit also provides a detection test strip which can be used for detecting RPA amplification products. The RPA primers are adopted to amplify sample DNA respectively, the amplification products are detected through the test strip, and whether the sample is infected with the African swine fever virus or not can be judged. The detection method established aiming at the nucleic acid of the African swine fever virus does not need special equipment, the reaction time is only 25 minutes, the sensitivity is up to 100 cp/microliter, no cross reaction exists in four common swine-origin viruses, and the specificity is high. The African swine fever virus nucleic acid rapid detection kit provides a simple and effective detection means for detecting the nucleic acid of the African swine fever virus, and is suitable for field detection.

The invention discloses primers and a reagent kit for rapidly detecting the specific vibrio parahemolyticus virulence plasmid pVA1 on site. The sequences of the primers are shown as SE ID NO:3-6. By the adoption of the primers, the specific vibrio parahemolyticus virulence plasmid pVA1 can be easily, conveniently, rapidly and visually detected, accuracy is high, specificity is good, detection time is short, and operation is easy and convenient.

The invention relates to the technical field of two-stage cone pulleys, and discloses a two-stage cone pulley phase angle error detecting device and a detecting method thereof. The device comprises ameasuring base, a two-stage cone pulley centering component, a pinion cogging positioning component and a large gear phase offset distance measuring component. The pinion cogging positioning componentis disposed at the pinion side of the two-stage cone pulley to be detected and radially positions the pinion cogging; the large gear phase offset distance measuring component is disposed on the largegear side of the two-stage cone pulley to measure the offset of the center position of a tooth socket being closet to the axis of the pinion cogging positioning component relative to the corresponding position of a two-stage cone pulley calibration component. The two-stage cone pulley phase angle error detecting device and the detecting method thereof employ the two-stage cone pulley centering component and the pinion cogging positioning component to locate the two-stage cone pulley to be detected to measure the deviation value to obtain an error value so as to greatly improve the detection efficiency of the two-stage cone pulley phase angle.

The invention discloses a purity measuring method of the 9-Fluorenylmethanol. Firstly it confects the marker of purity and the measured sample, then to detect relative chromatogram chart and the peak area using the HPLC; last to converse to 9-Fluorenylmethanol purity of the sample according to the quantity calculation formula of the external scaling method. The invention is first to use the HPLC and the ultraviolet multi-wave detector and the peak is edge and has high separation degree; the separating time is short; the relative standard deviation is 0.25% and the recovery rate is 98.1%-103.2%. The invention can be used to detect the 9-Fluorenylmethanol purity in production, use, the sale and study field.

The invention discloses a primer for detecting porcine circovirus 3, a PCR (polymerase chain reaction) kit and an application. The sequence of an upstream primer of the primer is 5' CGGGAAATCTGACTGAAGTT 3', and the sequence of a downstream primer of the primer is 5' ACTCCTCCGGTACAACATTA 3'. The primer has the advantages that the primer is a pair of specific primers designed for PCV3 (porcine circovirus 3) according to the sequence of the PCV3 in a GenBank, a method for rapidly and accurately detecting the PCV3 is built, strong in specificity, high in sensitivity and good in repeatability, anda rapid and accurate detection means is provided for laboratory diagnosis of the PCV3 and survey of the prevalence state of the PCV3 in Chinese swine herds.

A method for detecting mononucleotide polymorphism by conformational difference gel electrophoresis. The method comprises the following specific steps: (1) collecting samples; (2) extracting DNA of a sample genome; (3) selecting single nucleotide polymorphisms (SNPs) associated with disease occurrence, drug efficacy and toxicity for a polymerase chain reaction (PCR ) amplification; (4) carrying out conformational difference gel electrophoresis analysis on PCR products, and determining different genotypes according to position and number of bands; and (5) carrying out DNA sequencing on PCR products of samples with different band types, and determining specific genotypes of different samples. According to the invention, the analysis of SNPs is analysis of double-stranded PCR products, without requiring endonuclease; samples can be loaded directly for gel electrophoresis without any prior processing; and no expensive equipment or reagent is required; therefore the method has advantages of simple operation and low cost. This invention provides a fast, accurate, simple, and low-cost detection means for SNPs related to disease susceptibility and individualized drug therapy, and lays foundation for clinical application of the method.

The invention relates to application of a biomarker composition in preparation of a diagnostic reagent for fulminating myocarditis and a drug for fulminating myocarditis, belonging to the field of disease diagnostic reagents and drugs. The application is characterized in that the biomarker combination comprises Siglec-5, Siglec-5, Siglec-5, Siglec-5, Siglec-5 and Siglec-5, the combination of biomarkers is further selected from the group consisting of sST2, PAI-1, Siglec-5, CD163, CD40, P-Cadherin, CD14, and CTLA4, and the combination of biomarkers is selected from the group consisting of sST2, PAI-1, Siglec-5, CD163, CD40, P-Cadherin, CD14, and The invention finds that the expression of the biomarker in the plasma of a patient with the outbreak myocarditis is increased, and proves that the biomarker plays a role in diagnosing the outbreak myocarditis and the role of the biomarker as a drug target in relieving and/or improving the outbreak myocarditis, and the level of the biomarker can be detected, so that the application of the biomarker in the diagnosis of the outbreak myocarditis and the application of the biomarker in the treatment of the outbreak myocarditis can be realized. The biomarkers can be used for predicting and assisting in diagnosing the outbreak myocarditis or evaluating prognosis of the outbreak myocarditis, meanwhile, the level of the biomarkers is controlled through drugs, more intensified diagnosis and follow-up treatment can be carried out on diseases, and the biomarkers have huge clinical application value.

The invention discloses a thermal barrier coating service life measuring and calculating method. The method comprises the steps of obtaining historical use data of a user, component structure information of a thermal barrier coating and planned use working conditions of components; obtaining a life prediction model of the thermal barrier coating according to the obtained user historical use data, the component structure information of the thermal barrier coating and the planned use condition of the component; measuring a microstructure damage factor of the thermal barrier coating; correcting the fitting coefficient of the life prediction model through the measured microstructure damage factor of the thermal barrier coating, obtaining the corrected life prediction model, and obtaining the life of the thermal barrier coating. A thermal barrier coating nondestructive testing device is adopted to measure crack distribution and TGO layer key parameters of a service part, the measured data can be used for verifying and correcting a thermal barrier coating service life prediction algorithm and CFD boundary conditions, the accuracy of thermal barrier coating service life prediction is improved, and dynamic prediction of the thermal barrier coating service life in the part service period is achieved.