PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for distinguishing goose parvovirus from muscovy duck parvovirus

A PCR-RFLP, Muscovy duck parvovirus technology, applied in the field of molecular biology, achieves the effect of high efficiency and accuracy, and simple identification method

Active Publication Date: 2013-11-27
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no relevant report on the PCR-RFLP method for the NS gene difference between goose parvovirus and muscovy duck parvovirus at home and abroad, but there are related research reports on other types of viruses such as canine parvovirus, and the establishment of the present invention can fill the domestic gap. Blanks in related fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for distinguishing goose parvovirus from muscovy duck parvovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Virus strains:

[0028] Goose parvovirus and Muscovy duck parvovirus were isolated, identified and preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0029] 2. Primer design and synthesis

[0030] Primers P1 and P2 were designed according to the NS gene characteristics of goose parvovirus and muscovy duck parvovirus. The sequences of primers P1 and P2 were: upstream primer P1: 5'- CAAAATAAGACCGTGACT -3', downstream primer P2: 5'- ACAGGAGTAGGTTCAATACAAACA -3'.

[0031] 3. PCR amplification

[0032] The genomic DNA of goose parvovirus and Muscovy duck parvovirus was extracted by conventional methods. The designed specific primers P1 and P2 were used for PCR amplification, and the amplified fragment size was about 810 bp.

[0033] The amplification system was 50 μL, including 25 μL of 2×GoTaq Master Green Mix, 1 μL of upstream and downstream primers (20 μM / mL), 1 μL of DNA template, and supplemented w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for distinguishing a goose parvovirus from a muscovy duck parvovirus. According to the PCR-RFLP method, NS gene sequence digestion site difference is used for distinguishing the goose parvovirus from the muscovy duck parvovirus. The method comprises the following steps of: extracting DNA (deoxyribonucleic acid), carrying out PCR amplification to obtain an NS gene segment, and carrying out RFLP analysis after EcoRI digestion is carried out. The PCR-RFLP method for distinguishing the goose parvovirus from the muscovy duck parvovirus is simple and high in efficiency and accuracy.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for distinguishing goose parvovirus and muscovy duck parvovirus by using the difference in enzyme cutting sites of NS gene sequence method. Background technique [0002] Goose parvovirus (GPV) is the main autonomously replicating parvovirus that infects poultry. It was first discovered in 1956 by Chinese scholar Fang Dingyi in Yangzhou, Jiangsu Province (Fang Dingyi. Introduction to Goose Plague[J]. Chinese Journal of Veterinary Medicine, 1962, 8: 19-20; Wan Chunhe, Zhu Haixia, Huang Yu, et al. Analysis of the whole gene characteristics of a strain of goose parvovirus[J]. Chinese Journal of Animal Infectious Diseases, 2011, 1, 9 (4 ): 19-24.], the virus was also isolated in many countries later, the World Society of Poultry named the disease Derzsy in commemoration of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor万春和黄瑜陈红梅施少华程龙飞傅光华傅秋玲潘异哲
OwnerINST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI