A ssr marker related to cucumber fruit length traits and its application

Abstract

The invention provides SSR markers related to cucumber fruit length traits and applications thereof, belonging to the field of plant molecular breeding. Molecular marker SSR05572 closely linked to cucumber fruit length gene was disclosed for the first time, and the forward and reverse primer sequences of the marker were: 5'GCAAACCATAAGTTTCCCCA 3' and 5'GATCGATATTGCAACGAATTACA3', respectively. In BC4‑S2 constructed from the long-melon variety cucumber and the short-melon variety cucumber, the primers SSR05572F / SSR05572R could amplify a 204bp product in the long-melon strain and a 191bp product in the short-melon strain. The product containing two bands of 204bp and 191bp can be amplified in the heterozygous line, which is closely linked with the fruit length gene. The molecular marker closely linked with the cucumber fruit length gene disclosed by the invention can be used for cucumber fruit length gene positioning or molecular marker assisted breeding. It has important theoretical and practical guiding significance for accelerating the genetic improvement process of cucumber varieties and improving the efficiency of breeding selection.

Description

technical field [0001] The invention relates to genetic engineering and molecular biology, belongs to the field of molecular genetic breeding, provides SSR markers related to cucumber fruit length and application thereof, which can be used in molecular marker-assisted selective breeding of cucumber fruit length traits to improve breeding efficiency. [0002] technical background [0003] Cucumber (Cucumis sativus L.2n=2x=14) belongs to Cucurbitaceae Melon, an annual vine herb, and is one of the top ten vegetable crops in the world. my country's cucumber planting area and total output rank first in the world, but my country's cucumber output per unit area and export volume are lower than many countries. One of the key reasons for this contrast is the variety of high-quality cucumber varieties, especially Cucumber varieties suitable for protected cultivation are relatively scarce. Molecular-assisted selection can shorten the breeding cycle and improve breeding efficiency, and s...

AI Technical Summary

Problems solved by technology

Previous studies have been conducted on cucumber fruit length (Kennard&Havey, 1995; Serquen et al, 1997; Fazio et al, 2003; Yuanet al, 2007), and the melon length QTLs detected in these reports are between 4 and 6, However, due to the different test materials used, the number and location of QTL are also different, and the same anchor markers are lacking, and the fine mapping of fruit length-related genes has not been realized.

Images