SSR (Simple Sequence Repeat) marker related to length character of cucumber fruits and application of SSR marker

Abstract

The invention provides an SSR (Simple Sequence Repeat) marker related to a length character of cucumber fruits and application of the SSR marker and belongs to the field of plant molecular breeding. The invention discloses a molecular marker SSR05572 which is tightly interlocked with a length gene of the cucumber fruits for the first time; sequences of forward and backward primers of the marker are as follows: 5' GCAAACCATAAGTTTCCCCA 3' and 5' GATCGATATTGCAACGAATTACA 3'. In BC4-S2 constructed by cucumbers with a long-cucumber variety and cucumbers with a short-cucumber variety, the primers SSR05572F / SSR05572R can be amplified in a long-cucumber strain to obtain a 204bp product, can be amplified in a short-cucumber strain to obtain a 191bp product, and can be amplified in a heterozygosis strain to obtain a product with two stripes including 204bp and 191bp; the primers can be tightly interlocked with the length gene of the fruits. The molecular marker, which is tightly interlocked withthe length gene of the cucumber fruits, provided by the invention can be used for positioning the length gene of the cucumber fruits or carrying out molecular marker assisted breeding. The molecular marker has important theory and practice guiding significance of accelerating a genetic improvement process of cucumber varieties and improving the breeding selection efficiency.

Description

technical field [0001] The invention relates to genetic engineering and molecular biology, belongs to the field of molecular genetic breeding, provides SSR markers related to cucumber fruit length and application thereof, which can be used in molecular marker-assisted selective breeding of cucumber fruit length traits to improve breeding efficiency. technical background [0002] Cucumber (Cucumis sativus L.2n=2x=14) belongs to Cucurbitaceae Melon, an annual vine herb, and is one of the top ten vegetable crops in the world. my country's cucumber planting area and total output rank first in the world, but my country's cucumber output per unit area and export volume are lower than many countries. One of the key reasons for this contrast is the variety of high-quality cucumber varieties, especially Cucumber varieties suitable for protected cultivation are relatively scarce. Molecular-assisted selection can shorten the breeding cycle and improve breeding efficiency, and selection...

AI Technical Summary

Problems solved by technology

Previous studies have been conducted on cucumber fruit length (Kennard&Havey, 1995; Serquen et al, 1997; Fazio et al, 2003; Yuanet al, 2007), and the melon length QTLs detected in these reports are between 4 and 6, However, due to the different test materials used, the number and location of QTL are also different, and the same anchor markers are lacking, and the fine mapping of fruit length-related genes has not been realized.

Images