Molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines

Abstract

The invention discloses a molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines for the first time, and belongs to the field of molecular plant breeding. Sequences of forward and reverse primers for the molecular marker are respectively 5'CCCTCTGCTGCACATTATCC 3' and 5'TGCACCAAGCAATAACTTGTC 3'. In recombinant inbred line (RIL, Changchun-mi-ci x IL52) assemblage, a 192bp single band can be amplified by marking the SSR05793 in an individual disease-resistant plant; and a 204bp single band or 192bp-and-204bp double bands can be amplified by marking the SSR05793 in an individual susceptible plant. The molecular marker SSR05793 disclosed by the invention can be used for fine mapping of antibacterial keratoplaque genes and molecular-marker-assisted breeding of cucumber-sour cucumber introgression lines; and thus, the molecular marker SSR05793 is of important theoretical and practical guiding significance for accelerating bacterial-keratinococcus-resistant breeding of cucumbers.

Description

Technical field [0001] The invention discloses a molecular marker closely linked to a cucumber-pickled cucumber introgression system anti-bacterial angular spot disease gene, belongs to the technical field of vegetable molecular genetic breeding, and can be used for the auxiliary breeding of cucumber bacterial angular spot disease resistance molecular marker. technical background [0002] Cucumber is one of the main vegetables cultivated in a large area in my country, which has extremely high social value and economic benefits. Cucumber bacterial angular leaf spot is a widespread disease worldwide. Its pathogenic bacteria is the bacterium Pseudomonas syringaepv.lachrymans, which can infect cucumber leaves and fruits. It has a short incubation period, frequent re-infection, and strong epidemic The annual occurrence and other characteristics have brought serious economic losses to cucumber production. The most economical and effective way to control bacterial angular leaf spot of ...

AI Technical Summary

Problems solved by technology

[0003] At present, there are many studies on the genetic analysis of cucumber bacterial keratosis resistance, and there are two main views. One view is that the resistance of cucumber bacterial keratosis is controlled by a single recessive gene, and the other view is that cucumber bacterial keratosis is controlled by a single recessive gene. The resistance to keratosis is controlled by multiple genes, but the genetic mapping of the resistance genes to bacterial keratosis in cucumber has not been reported yet.

In addition, the selection of cucumber materials or varieties resistant to bacterial angular leaf spot mainly relies on phenotypic identification by natural disease in the field or inoculation at the seedling stage. The efficiency of phenotypic selection is not high, the breeding is difficult, and the bred cucumber varieties have disadvantages such as unstable resistance to bacterial angular spot and easy to be affected by the cultivation environment.

Images