Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines

A molecular marker and bacterial technology, applied in the field of molecular genetics and breeding of vegetables, can solve the problems of being easily affected by external conditions, time-consuming, and difficulty in breeding, achieving convenient identification, low resolution reliability, and accurate gene locus. Effect

Active Publication Date: 2019-04-12
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are many studies on the genetic analysis of cucumber bacterial keratosis resistance, and there are two main views. One view is that the resistance of cucumber bacterial keratosis is controlled by a single recessive gene, and the other view is that cucumber bacterial keratosis is controlled by a single recessive gene. The resistance to keratosis is controlled by multiple genes, but the genetic mapping of the resistance genes to bacterial keratosis in cucumber has not been reported yet.
In addition, the selection of cucumber materials or varieties resistant to bacterial angular leaf spot mainly relies on phenotypic identification by natural disease in the field or inoculation at the seedling stage. The efficiency of phenotypic selection is not high, the breeding is difficult, and the bred cucumber varieties have disadvantages such as unstable resistance to bacterial angular spot and easy to be affected by the cultivation environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines
  • Molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines
  • Molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] In the spring of 2017, the ‘Changchun dense thorn’, ‘IL52’, F 1 155 RIL populations constructed by (Changchun dense thorn × IL52) and "Changchun dense thorn × IL52" were used to identify bacterial keratoderma resistance phenotypes, and the separation ratio of resistant and susceptible phenotypes in the RIL population was calculated, and bacterial keratoderma was calculated. The genetic analysis of disease resistance revealed that'Changchun Misi' is susceptible to bacterial keratoderma, and'IL52' is resistant to bacterial keratoderma figure 1 ), F 1 (Changchun dense thorn × IL52) susceptible to bacterial keratoderma, the separation ratio of resistance to susceptibility in the RIL population accords with 1:1 2 =0.161, P=0.688) (Table 1), indicating that the bacterial keratoderma resistance in'IL52' is controlled by a single recessive gene als.

[0027] Table 1 Analysis of the genetic law of bacterial angular leaf spot disease resistance in cucumber-pickled cucumber introgressi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker SSR05793 closely linked to antibacterial keratoplaque genes of cucumber-sour cucumber introgression lines for the first time, and belongs to the field of molecular plant breeding. Sequences of forward and reverse primers for the molecular marker are respectively 5'CCCTCTGCTGCACATTATCC 3' and 5'TGCACCAAGCAATAACTTGTC 3'. In recombinant inbred line (RIL, Changchun-mi-ci x IL52) assemblage, a 192bp single band can be amplified by marking the SSR05793 in an individual disease-resistant plant; and a 204bp single band or 192bp-and-204bp double bands can be amplified by marking the SSR05793 in an individual susceptible plant. The molecular marker SSR05793 disclosed by the invention can be used for fine mapping of antibacterial keratoplaque genes and molecular-marker-assisted breeding of cucumber-sour cucumber introgression lines; and thus, the molecular marker SSR05793 is of important theoretical and practical guiding significance for accelerating bacterial-keratinococcus-resistant breeding of cucumbers.

Description

Technical field [0001] The invention discloses a molecular marker closely linked to a cucumber-pickled cucumber introgression system anti-bacterial angular spot disease gene, belongs to the technical field of vegetable molecular genetic breeding, and can be used for the auxiliary breeding of cucumber bacterial angular spot disease resistance molecular marker. technical background [0002] Cucumber is one of the main vegetables cultivated in a large area in my country, which has extremely high social value and economic benefits. Cucumber bacterial angular leaf spot is a widespread disease worldwide. Its pathogenic bacteria is the bacterium Pseudomonas syringaepv.lachrymans, which can infect cucumber leaves and fruits. It has a short incubation period, frequent re-infection, and strong epidemic The annual occurrence and other characteristics have brought serious economic losses to cucumber production. The most economical and effective way to control bacterial angular leaf spot of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 陈劲枫张开京李季魏义凡
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com