Application of the sex tag pir-mmu-72274 in half-smooth tongue sole
A semi-smooth tongue sole and gender technology, applied in the application field of semi-smooth tongue sole gender tag piR-mmu-72274, to achieve reliable identification results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019]A semi-sliding tongue semen source of exosomes PIR-MMU-72274 as a screening method of biomarkers.
[0020]1. Collection of semen samples
[0021]The semi-slip tongue is collected by 0.5 ml of the centrifugal tube for the isolation and identification of the subjuncus.
[0022]2, extraction of the exosomes
[0023](1) Take 0.5mL semen sample transfer 1.5MLEP tube, placed at 4 ° C, 1200 g from 15 min to remove sperm cells, 4 ° C, 15000 g from 20 min to remove small cell impurities and debris, dilute 1 times with PBS, use 0.45 um filter Pre-filtration was performed, and the filtration was filtered again.
[0024](2) Filtered samples were extracted with the Total Exosome ISOLATION KIT kit.
[0025](3) Collect the dissolution and transfer to a 2 ml tube without RNase.
[0026]3, Identification of Prospectus: Hitachi H600IV transmission electron microscope observation, after transmission electron microscopy analysis, the remaining sample is used for RNA extraction and sequencing analysis.
[0027]4. PiRNA s...
Embodiment 2
[0032]Half-slip tongue semen 外体 miRNA marker identified male fish and pseudo-rootless kit
[0033]Identification kit based on semen of semen exeracene piRNA marker PIR-MMU-72274 includes PIR-MMU-72274 quantitative detection primers, primer sequences are f: gcttggtgttcagtgt, R: TcgtatccagTGCAGGTC, PCR reverse transcription reagent and PCR fluorescent quantitative reagent, interconnected PIR as U6, primers U6-F: CTCGCTTCGGCAGCACATATACT; U6-R: ACGCTTCACGAATTTGCGTGTC; primer comprising a reverse transcription primer piR-mmu-72274-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAAGGCGAGA, furthermore kit comprises other conventional reagents quantitative PCR reactions: reverse transcriptase, Taq polymerase , DNTP, Buffer, MGCL2, DEPC water and anticipants. The reactive system of the kit is 10 ul system, namely 0.5 ul 10 * miRNA primer probe, 5 ul 2 * master mix, 2.5 ul DDH2O, 2 ulcDNA template. The Q6 real-time fluorescent quantitative PCR was detected using the q6 of Thermo Fisher, and the p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


