Application of pir-mmu-31018127 exosomes in tongue sole

A technology of semi-smooth tongue sole and exosomes, which is applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effect of reliable identification results

Active Publication Date: 2021-04-27
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In marine animals, there is almost no report on the research on exosome-derived piRNA as a biomarker. The present invention develops a method for the extraction and preliminary application of exosomes derived from fish seminal plasma represented by semi-smooth tongue sole, and solves the problem of semi-smooth tongue sole male fish and Discrimination of the Genetic Sex of Pseudo-Male Fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pir-mmu-31018127 exosomes in tongue sole
  • Application of pir-mmu-31018127 exosomes in tongue sole
  • Application of pir-mmu-31018127 exosomes in tongue sole

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] A screening method for exosomal piR-mmu-31018127 derived from tongue sole semen as a biomarker.

[0019] 1. Collection of semen samples

[0020] Collect 0.5 ml of semen from sexually mature males of semi-smooth tongue sole in a centrifuge tube for the isolation and identification of exosomes.

[0021] 2. Extraction of exosomes

[0022] (1) Transfer 0.5ml semen sample to 1.5ml EP tube, place at 4°C, centrifuge at 1200g for 15min to remove sperm cells, centrifuge at 15000g at 4°C for 20min to remove small cell impurities and debris, dilute 1 times with PBS, and use 0.45um filter membrane Perform pre-filtration, and then filter the filtrate through a 0.22um membrane filter.

[0023] (2) Exosomes were extracted from the filtered samples using the Total Exosome Isolation Kit.

[0024] (3) Collect the lysate and transfer completely to an RNase-free 2ml tube.

[0025] 3. Identification of exosomes: Hitachi H600IV transmission electron microscope observation, after transmis...

Embodiment 2

[0031] Kit for identification of male and pseudo-male by exosome miRNA markers in semismooth tongue sole semen

[0032] The identification kit based on semen exosome piRNA marker piR-mmu-31018127 includes piR-mmu-31018127 quantitative detection primers, primers, F:TACGCATGTGGTTCAGTGGT, R:TCGTATCCAGTGCAGGGTC, reverse transcription primer is piR-mmu-31018127-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACACTGGCGAGACG , and other PCR reverse transcription reagents and PCR fluorescent quantitative reagents, the internal reference piR is U6, and the primers are U6-F: CTCGCTTCGGCAGCACATACT; U6-R: ACGCTTCACGAATTTGCGTGTC; primers include reverse transcription primers, quantitative PCR forward primers and reverse primers, and other reagents The box contains other conventional reagents for quantitative PCR reactions: reverse transcriptase, Taq enzyme, dNTP, buffer, Mgcl 2 , DEPC water and reference substance. The reaction system used in this kit is a 10ul system, that is, 0.5ul 10*miRNA primer ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the application of a semi-smooth tongue sole piR-mmu-31018127. The sex tag piR-mmu-31018127 is derived from fish seminal plasma exosomes. The present invention screens out the tag piRNAs significantly differentially expressed in two fishes through small RNA sequencing analysis As a candidate, through real-time quantitative PCR verification, the piRNA biomarkers that can indicate the two fishes were finally determined. The tag piRNAs were piR-mmu-31018127, and the sequence was GCATGTGGTTCAGTGGTAGAATTCTCGCCG. Based on this, a detection kit was developed and prepared. The method of the invention has the advantages of non-invasiveness and high efficiency, and the identification result is reliable, and it is the first time that the genetic sex of the tongue sole is discriminated through quantitative detection.

Description

technical field [0001] The invention belongs to the field of fish biotechnology, and in particular relates to the application of a sex tag piR-mmu-31018127 in tongue sole of half-smooth tongue sole as a sex tag. Background technique [0002] Due to the huge difference in growth rate and body size between female and male fish, as well as the high proportion of male fish in breeding and low economic value, the industrial development of half-smooth tongue sole (Cynoglossus semilaevis) is restricted to a certain extent. The study found a high proportion of pseudomale fish among male fish, that is, fish that are genetically female but phenotypically male. However, if the pseudo-male is used as the male parent, the offspring will also inherit the characteristics of the father and become a pseudo-male, which leads to the problem of a high proportion of males. Therefore, the identification of pseudo-male fish is of great significance to the breeding industry of half-smooth tongue s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6888C12Q1/6879
CPCC12Q1/6879C12Q1/6888C12Q2600/158
Inventor张博赵娜贾磊车金远高磊李仰真鲍宝龙刘克奉
OwnerTIANJIN BOHAI SEA FISHERIES RES INST