A kind of lrwrky2 gene of Minjiang lily and its application
A gene and lily technology, applied in Lilium Minjiang LrWRKY2 gene and its application field, can solve the problems of biological function and transcription regulation mechanism that are far from elucidated
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Cloning Lilium Minjiang LrWRKY2 full-length gene sequence
[0035] Currently, Minjiang Lily ( Lilium regale Wilson's genome sequencing has not yet fully started, and the research group obtained relevant information through the sequencing and analysis of transcripts from different organizations LrWRKY2 reads sequence, through sequence splicing, its full-length sequence was preliminarily obtained; in order to verify the real existence of LrWRKY2 The full-length gene, and then design specific primers (LrWRKY2-ATG-F and LrWRKY2-Stop-F) for PCR amplification analysis.
[0036] The leaf tissue of Minjiang Lily at the budding stage was taken as the material, and the total RNA was extracted by using TRIzol™ Plus RNA Purification Kit (12183555, Invitrogen™) according to the instruction manual, and the residual trace DNA was removed by DNase I (18047019, Invitrogen™), and analyzed by a spectrophotometer Determine the concentration of RNA and set aside.
[0037] Ab...
Embodiment 2
[0045] Example 2 Recombinant expression vector p -TF101- P35S::GFP-LrWRKY2-NOS Construction and subcellular localization analysis
[0046] (1) Build p -TF101- P35S::GFP-LrWRKY2-NOS Expression vector
[0047] Minjiang lily LrWRKY2 For the full-length gene sequence (SEQ ID NO.1), design primers LrWRKY2-gfp-F and LrWRKY2-gfp-R, and introduce seamless cloning (In-fusion) vector adapter sequence and restriction site sequence into the primers. Using the TA-connected positive clone plasmid in Example 1 as a template, use LrWRKY2-gfp-F (forward primer) and LrWRKY2-gfp-R (reverse primer) as primers for gene expression LrWRKY2 specific amplification.
[0048] The primer sequences are as follows:
[0049] LrWRKY2-gfp-F:
[0050] 5'- TTCCCCGGGCTCGAGAAGCTT ATGGAGAACAAAATGGGATGG-3';
[0051] LrWRKY2-gfp-R:
[0052] 5'- TTATCTAGATCCGGTGGATCC TCACCACCACCTGAAGTTGG-3';
[0053] Among them, the bold sequence of LrWRKY2-gfp-F is the Hind III restriction site, and the bold sequenc...
Embodiment 3
[0066] Example 3 Recombinant expression vector pBI121 - P35S::LrWRKY2-NOS Construction and genetic transformation of Arabidopsis
[0067] (1) Build pBI121 - P35S::LrWRKY2-NOS overexpression vector
[0068] Minjiang lily LrWRKY2 For the full-length gene sequence (SEQ ID NO.1), design primers LrWRKY2-inf-F and LrWRKY2-inf-R, and introduce seamless cloning (In-fusion) vector adapter sequence and restriction site sequence into the primers. Using the positive cloning plasmid connected by TA in Example 1 as a template, and using LrWRKY2-inf-F and LrWRKY2-inf-R as primers for gene expression LrWRKY2 specific amplification.
[0069] The primer sequences are as follows:
[0070] LrWRKY2-inf-F:
[0071] 5'- GGACTCTAGAGGATCC ATGGAGAACAAAATGGGATGG-3'
[0072] LrWRKY2-inf-R:
[0073] 5'- GATCGGGGAAATTCGAGCTC TCACCACCACCTGAAGTTGG-3'
[0074] Among them, the bolded sequence of the forward primer LrWRKY2-inf-F is the BamHI restriction site, and the bolded sequence of the re...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



