Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, kit and method for detecting glucose-6-phoshate dehydrogenase deficiency G6PD gene mutation

A phosphate dehydrogenase, G6PD-F technology, applied in the field of life science and biology, can solve problems such as chronic hemolysis, and achieve the effect of cumbersome operation, reduced sample and reagent usage, and high cost

Pending Publication Date: 2019-10-22
SHANGHAI ADICON CLINICAL LAB LNC
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Certain G6PD-related gene mutations can cause chronic hemolysis, leading to hereditary aspherocytic anemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and method for detecting glucose-6-phoshate dehydrogenase deficiency G6PD gene mutation
  • Primer, kit and method for detecting glucose-6-phoshate dehydrogenase deficiency G6PD gene mutation
  • Primer, kit and method for detecting glucose-6-phoshate dehydrogenase deficiency G6PD gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Primers for detecting mutations at c.1376 and c.1388 of the G6PD gene, which are amplification primers specifically designed for c.1376 and c.1388 of the G6PD gene:

[0034] A kit for detecting mutations at c.1376 and c.1388 of the G6PD gene, including

[0035] (i) blood / tissue DNA extraction reagents;

[0036] (ii) detection system PCR reaction solution;

[0037] (iii) Sequencing system reagents;

[0038] (iv) Positive control substance and negative control substance.

[0039] Among them, blood / tissue DNA extraction reagents can be purchased from commercial reagents such as Tiangen DNA Extraction Kit.

[0040] Detection system PCR amplification reaction solution includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); G6PD-F (10μM), G6PD-R (10μM).

[0041] G6PD-F:TGTAAAACGACGGCCAGTGCAGCCGTCGTCCTCTATG

[0042] G6PD-R: AACAGCTATGACCATGCACCTGCCATAAATATAGGGGAT;

[0043] Sequencing system reagents include: sequencing purification solution (ExoI: 0.6U, CIP: 1....

Embodiment 2

[0047] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0048] (1) Extract tissue DNA from blood:

[0049] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.

[0050] 2) Add 20 μl proteinase K solution and mix well.

[0051]3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0052] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0053] 5) Add the solution and floccul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting hotspot mutation of the gene G6PD associated with glucose-6-phoshate dehydrogenase deficiency. The primer comprises primer bodies, at the sites c.1376 and c.1388, for amplifying the G6PD. By using a Sanger sequencing technology, the primer can be used for quickly detecting the mutation conditions of the sites c.1376 and c.1388 in the body of a G6PD patient. The detection result completed by using the primer is accurate, and the method has an important reference significance for rapid diagnosis of the G6PD patient.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer, a method and a kit for detecting the c.1376 and c.1388 site mutations of the glucose-6-phosphate dehydrogenase deficiency-related gene G6PD. Background technique [0002] Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most common erythrocyte enzymatic diseases in humans, affecting more than 400 million people worldwide. It is also the most common hereditary blood disease in southern my country, and its essence is the mutation of the G6PD gene. [0003] G6PD is an enzyme that exists in human red blood cells and participates in the regulation of the redox process in the human body. It is related to the production of the most important reducing substance in the human body, reduced coenzyme II. Reduced coenzyme II is a hydrogen donor in many biochemical reactions in the body, protecting cell membranes from oxidative damage. If th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2600/166C12Q2531/113C12Q2535/122C12Q2545/113
Inventor 林筱剑
Owner SHANGHAI ADICON CLINICAL LAB LNC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More