Double sgRNA targeting frzb gene knockout and frzb gene knockout porcine fibroblast cell line and its application

A pig fibroblast and cell line technology, applied in the field of genetic engineering, can solve the problem of no gene knockout cell line, etc., and achieve the effect of great applied research value and complete knockout effect.

Active Publication Date: 2022-02-11
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the function of porcine FRZB gene, and there is no related gene knockout cell line

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double sgRNA targeting frzb gene knockout and frzb gene knockout porcine fibroblast cell line and its application
  • Double sgRNA targeting frzb gene knockout and frzb gene knockout porcine fibroblast cell line and its application
  • Double sgRNA targeting frzb gene knockout and frzb gene knockout porcine fibroblast cell line and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Construction and detection of CRISPR / Cas9 targeting vector targeting FRZB gene

[0043] 1. Sequence design of FRZB gene sgRNA

[0044]Download the porcine FRZB gene sequence (accession number NC_010457.5) from the NCBI website, use the website http: / / crispr.mit.edu / to design knockout target sites on the first exon of the gene, and select 10 PCR sequencing of the sgRNAs showed that the nesting peaks were not obvious, and the editing efficiency was low. Four sgRNAs with relatively high nesting peaks were selected and combined in pairs, and the editing efficiency was improved. Finally, the one with the highest sequencing peaks and the highest editing efficiency was selected. A set of double sgRNA, the two target sequences are FRZB-sgRNA1: CAGCACTCAGGCCAACGCCA (shown in SEQ ID NO: 1), FRZB-sgRNA2: CTCGTGGCCGGAAAGCCTGGC (shown in SEQ ID NO: 4). According to the BbsI restriction endonuclease, design restriction endonuclease sites at both ends of the sgRNA, add CAC...

Embodiment 2

[0067] Example 2 Construction and Genome Identification of FRZB Gene Knockout Pig Fibroblast Cell Line

[0068] 1. Screening of positive monoclonal cells

[0069] (1) When the porcine fibroblasts grow to a confluence of 70% to 90%, prepare a mixture containing 150 μL electroporation solution, 5 μg pX330-EGFP-FRZB-sgRNA1 and 5 μg pX330-EGFP-FRZB-sgRNA2 expression vector, use Lonza The T-024 program of the electroporation instrument was used for electroporation.

[0070] (2) After 6 hours of electroporation, replace with growth medium containing 10% fetal bovine serum. After 48 hours of transfection and electroporation, a large number of successfully transfected green fluorescent positive cells can be seen under the microscope (such as Figure 4 shown), the positive single clones with green fluorescence were sorted out by flow cytometry, and injected into a 96-well plate with preheated medium at the amount of 1 cell per well, and replenished every 3 to 4 days. Add the culture...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, in particular to a double sgRNA targeted to knock out the FRZB gene and a porcine fibroblast cell line for knocking out the FRZB gene and applications thereof. The present invention provides a double sgRNA targeted to knock out the FRZB gene, which cuts two sites on the first exon of the FRZB gene, and then constructs the sgRNA into an expression vector and then transfects pig fibroblasts through an optimized electroporation system cells, and then use flow cytometry to sort out high-purity positive monoclonal cells, and obtain FRZB knockout cell lines through genomic identification and screening. The invention solves the problems of low transfection efficiency, low targeting efficiency and low monoclonal purity in the process of constructing a knockout cell line, and is easy to operate and obtains an edited cell line with longer segment deletions. The involved cell lines can be used as donors of somatic cell nuclear transfer for the preparation of transgenic pigs, which provide a better research tool for deeply exploring the biological functions of FRZB genes.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a double sgRNA targeted to knock out the FRZB gene and a porcine fibroblast cell line for knocking out the FRZB gene and applications thereof. Background technique [0002] Gene knockout is an effective means to study gene function and genetic improvement. CRISPR / Cas9 is currently the most commonly used gene editing system, widely used in the research of gene function and transgenic animal preparation. The main principle is to guide the Cas9 protein to the genomic region complementary to its sequence through sgRNA, so that the Cas9 protein binds to the target genome sequence, and performs genome cutting to cause DNA double-strand breaks, usually through non-homologous end repair. Insertion or deletion of one or several bases can be generated to achieve the purpose of gene function knockout. However, because the method for predicting the efficiency of sgRNA is not pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/90C12N15/85C12N5/10C12N15/11C12Q1/6888C12Q1/02A01K67/027C12R1/91
CPCC12N15/113C12N15/907C12N15/8509C12N5/0656A01K67/0276G01N33/5005C07K14/4703C07K14/475C12Q1/6888C12N2310/20C12N2510/00A01K2217/075A01K2227/108A01K2267/03
Inventor张博付玉张盼商鹏张然张浩
OwnerCHINA AGRI UNIV