Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication and detection of novel coronavirus

An RNA primer and specific technology, applied in the field of DNA-RNA hybrid double-strand specific conjugates, can solve the problems that the application has not yet been developed and applied

Active Publication Date: 2021-07-30
SUZHOU HAIMIAO BIOTECH CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the application of DNA-RNA hybrid double-stranded conjugates including antibodies disclosed in the present invention in promoting nucleic acid replication has not yet been developed and applied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication and detection of novel coronavirus
  • Application of DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication and detection of novel coronavirus
  • Application of DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication and detection of novel coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Several DNA-RNA hybrid double-strand specific conjugates are used for the detection of novel coronavirus (SARS-CoV-2) oropharyngeal swab samples:

[0039] The reverse transcription and amplification reactions described in this embodiment and other embodiments of the present invention use artificially synthesized primers and probes with the following sequences.

[0040] Novel coronavirus detection, corresponding sequence NC_045512.2;

[0041] N gene primer sequence:

[0042] F1: AAATGTCTGATAATGGACCCCAA, SEQ ID No.1 (the corresponding position in the gene is 28274-28294);

[0043] R1: GCCGACGTTGTTTTGATCGC, SEQ ID No.2 (the position in the corresponding gene is 28378-28397);

[0044] The probe sequence is:

[0045] P1: FAM-CTGAG GGTCCACCAAACGTAATGC-BHQ, SEQ ID No. 3 (corresponding to positions 28314-28337 in the gene).

[0046] The sequence of the E gene primer is:

[0047] F2: AGTTACACTAGCCATCCTT, SEQ ID No.4 (corresponding to 26328-26346 in the gene);

...

Embodiment 2

[0064] Example 2: DNA-RNA hybrid double-strand specific conjugates are used for DNA detection:

[0065] The following several DNA-RNA hybrid double-strand specific conjugates described in the present invention (anti-DNA-RNA hybrid double-strand mouse antibody (such as Absolute Antibody Ab01137-2.0), hybridoma monoclonal antibody HB8730 (such as QIAGEN 5198-1220), anti-DNA-RNA hybrid double-stranded rabbit antibody (such as Absolute Antibody Ab01137-23.0) is used for the human ACTB gene detection of DNA template. The RT-PCR reaction setting is the same as that of Example 1.

[0066] The method of comparison is to use human-derived genomic DNA samples (about 2ng / μL) for detection, and compare the Ct values ​​of RT-PCR amplification of the samples in the group containing three conjugates and the group without conjugates. Each sample was tested in triplicate to evaluate the effect of different heterozygous double-strand specific conjugates on the RT-PCR detection effect of DNA tem...

Embodiment 3

[0071] Example 3: DNA-RNA hybrid double-strand specific conjugates enhance human mRNA reverse transcription:

[0072] The following several DNA-RNA hybrid double-strand specific conjugates described in the present invention (anti-DNA-RNA hybrid double-strand mouse antibody (such as Absolute Antibody Ab01137-2.0), hybridoma monoclonal antibody HB8730 (such as QIAGEN 5198-1220), anti-DNA-RNA hybrid double-stranded rabbit antibody (such as Absolute Antibody Ab01137-23.0) is used to enhance the efficiency of mRNA reverse transcription.

[0073] The comparison method is to use human total RNA samples (remove DNA) and synthesize three poly(dT) primers of different lengths: dT8 / dT12 / dT16 (8 / 12 / 16 bases in length, respectively) for total mRNA reverse transcription , and then detect the ACTB reverse transcription cDNA. Through the comparison of the Ct value of PCR amplification of the reverse transcription product in the three groups containing the conjugate group and the non-conjugat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication. The DNA-RNA hybrid double-stranded specific conjugate is an antibody or a binding factor capable of specifically recognizing DNA-RNA hybrid double strands. A DNA primer is used, RNA are used as a template, or the RNA primer is used, DNA is used as the template, and the affinity of the DNA primer and the RNA template or the affinity of the RNA primer and the DNA template independent of a nucleic acid sequence is improved by using the DNA-RNA hybrid double-strand specific conjugate, so that the primer design is not limited by the sequence, meanwhile, the primer-template structure stability is promoted, the transcription and replication efficiency is improved, and the amplification efficiency of downstream nucleic acid after replication is improved.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to a new application of a DNA-RNA hybrid double-strand specific conjugate. Background technique [0002] DNA-RNA hybrid duplex is an important intermediate in cell life activities, and the formation of DNA-RNA hybrid duplex is the initiation of DNA transcription or RNA reverse transcription. Both DNA transcription and reverse transcription of RNA viruses produce DNA-RNA hybrid duplexes. [0003] DNA-RNA hybrid double strands can also be artificially generated, for example, in the process of cDNA reverse transcription using RNA template and reverse transcriptase in vitro, DNA primers and the cDNA strand and RNA synthesized and replicated by reverse transcriptase on the RNA template strand The template strand forms a DNA-RNA hybrid duplex. [0004] The cDNA replicated by the reverse transcription reaction has important applications in molecular biology and clinical applic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686C12Q1/70
CPCC12Q1/686C12Q1/701C12Q1/6886C12Q1/6883C12Q2600/158C12Q2600/178C12Q2521/107C12Q2527/125C12Q2525/207Y02A50/30
Inventor 陈华谭淼
Owner SUZHOU HAIMIAO BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More