Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Streptococcus zooepidemicus strain and application thereof

A technology of Streptococcus zooepidemicus and strains, applied in the field of Streptococcus zooepidemicus strains and fermented production of hyaluronic acid, which can solve the problems of long mutagenesis breeding cycle, large uncertainty of results, and increased production costs

Pending Publication Date: 2022-03-04
HEC PHARM
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production of HA by microbial fermentation also presents many limitations
Affected by the host bacteria, the ability of different hosts to produce HA is different, but the output of the shaker flask is mostly less than 1g / L, and the output of the fermenter is generally within 7g / L, which not only increases the production cost, but also makes it difficult to meet the growing market demand
As far as the current host improvement technology is concerned, chemical mutagenesis or physical mutagenesis technology is one of the mainstream methods for screening excellent production strains, but the drawbacks of long mutagenesis breeding cycle, large uncertainty of results, and high toxicity are often limitations. one of the main factors in its development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptococcus zooepidemicus strain and application thereof
  • Streptococcus zooepidemicus strain and application thereof
  • Streptococcus zooepidemicus strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The screening of embodiment 1 Streptococcus zooepidemicus

[0029] The inventor purchases some fresh bovine noses from the market, disinfects and cleans the exposed parts around them; wipes the inside of the bovine nose with a cotton swab, cuts off the head of the cotton swab with sterile scissors, puts it in BHI liquid medium, and cultures it at 37°C and 220rpm for 12- 18h. According to the turbidity of the medium, it was diluted to 10 -3 、10 -4 and 10 -5 , take 100 μL and spread it on the BHI solid medium, culture at 37°C for 24 hours, observe the shape and viscosity of the single colony, and preliminarily screen out the colonies with grayish white color, smooth and moist surface, and round protrusions, pick them up with the tip of a gun A total of 20 strains of bacterial colonies with obvious stickiness were used and marked as F1-F20.

[0030] Single colonies of F1-F20 were picked out on the blood plate for streak expansion, cultured at a constant temperature of ...

Embodiment 2

[0049] Embodiment 2 Glucokinase gene overexpression strain construction process

[0050] The Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus with primer 01F / 01R, wherein, 01F was introduced into the BglⅡ restriction site; the sequence was cloned from the genome of Streptococcus zooepidemicus with primer 02F / 02R A glucokinase gene (GcK gene) was obtained, and the sequence of the cloned GcK gene is shown in SEQ ID NO:17.

[0051] ATGAGTCAAAAATTGATAGGGATTGATTTGGGCGGAACCACGATTAAATTTGGTAT TTTAACCTCAGAGGGTGACGTTCAGGAAAAATGGGCGATTGAGACAAATGTTTTAGA GGACGGTAAACATATCGTTCCAGATATTGTCGCCTCACTCAAGCATCGCCTTGACCTTT ATGGACTGACTAAGGACGATTTTATCGGTATTGGTATGGGCTCACCTGGAGCTGTCAAT CGCACAGATCATACTGTTACAGGGGCCTTTAACCTCAACTGGAGAGGCACCCAAGAG GTGGGATCTGTTATTGAAAGGGAGCTAGGAATTCCCTTTGCTATTGATAATGACGCAAA TGTTGCGGCCCTCGGCGAGCGCTGGGTCGGTGCAGGTGACAATAATCCTGATGTGGTC TTTATGACCTTAGGAACAGGTGTTGGTGGTGGTATCATCGCTGATGGGAACTTGATTCA TGGTGTGGCTGGAGCTGGTGGT...

Embodiment 3

[0059] Embodiment 3 glucokinase gene integration strain construction process

[0060] The PGT expression cassette was integrated into the alcohol dehydrogenase (ADH) site of Streptococcus zooepidemicus genome, and the ADH homology arm sequence is as follows:

[0061]CAGCTTAAAGTGATGTGTTACCATCTTAGTTGCATCAATCTTACCTGATTTTAGAA CATTTAATAGCATTTCTGTCGTATTGGCATTTACTAGGCCAGTTGACATCGTAATATTTTT GATCCATAGGTCCTGTAGATCCAAGCTAACTGGTTTTCCATGAACACCAACGTTAGAA ACATGCCCGCCTATAGCAACAATCTTTTGACAGATATCAAAGGTAGCAGGATAGCCCA CACACTCAATAGCAACATCAACGCCTCGACCATCAGTTAATTCATGGACTTTTTTAACAATATCATCAAGGTCACCAGAACAACTGCTTGAGGAATATGAACATACTCTGCTTGTGTC CCATTAATCAAATGCCCTAGAATCCAACCACCGCTTTCACAATGAGCAGGAATTCCTTT TTTACAATAATAGCAGGTATTGCAGGCTGTGATACAGGAAATAATAACCTTATCACCTA CCTTAAAATTATTCACTGCAGAGCCAACTGACTCGACAATACCAATACCTTCATGACCT AAAATGGTACCATGAGTAGTCTCTGGGACATCTCCACCTAAAATATGCAAATCTGTTCC ACAGATTGTTGTTTTCAATAAACGAACCACAGCATCCGTCGGAGCAAGAATCTCTGGT TTTGG(SEQ ID NO:18)。

[0062] 其中, CAGCTTAAAGTGATGTGTTACCATCTTAGTTGCATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a streptococcus zooepidemicus strain. The glucokinase gene of the streptococcus zooepidemicus strain is overexpressed. After the streptococcus zooepidemicus strain disclosed by the embodiment of the invention is subjected to fermentation treatment, the yield of the obtained HA is obviously improved.

Description

technical field [0001] The invention relates to the field of biotechnology, specifically, the invention relates to a strain of Streptococcus zooepidemicus and its application, and more specifically, the invention relates to a strain of Streptococcus zooepidemicus and a method for producing hyaluronic acid by fermentation. Background technique [0002] Hyaluronic acid (hyaluronic acid or hyaluronan, HA) is a polysaccharide composed of disaccharide repeating units of glucuronic acid and glucosamine, widely distributed in the dermis and epidermis of cartilage tissue, joint fluid, and skin tissue, and in which It plays physiological functions such as moisturizing, nourishing, repairing and preventing damage. The production methods of hyaluronic acid include animal tissue extraction method and fermentation method. Due to the high preparation cost and complicated separation and purification of animal tissue extraction method, it is gradually replaced by fermentation method. [00...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74C12P19/26C12R1/46
CPCC12N9/1205C12Y207/01002C12N15/746C12P19/26
Inventor 谭秀梅李凯峰鲍素敏石江水谢文平
Owner HEC PHARM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com