BnALS1 mutant gene and protein based on gene editing and application of BnALS1 mutant gene and protein
A mutation-type, base-editing technology, which is applied in the fields of application, genetic engineering, and plant gene improvement, can solve the problems of low gene site-directed mutation efficiency and lack of base-editing technology, and achieve the effect of enriching germplasm resources
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2020-05-08
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the BnALS1 mutant gene and protein of Brassica napus based on gene editing, and the application thereof. Background technique
[0002] As one of the biological stresses, field weeds compete with crops for nutrients and growth space, seriously affecting the growth and yield of crops; on the other hand, manual and mechanical weeding increase the production cost of crops. Spraying herbicides is the most effective means of controlling weeds, and it can promote the development of crop production in the direction of high efficiency, low cost and light simplification.
[0003] There are many kinds of weeds in my country's rapeseed fields, the number is large, and the damage is serious. According to statistics, the damage of weeds can reduce the yield of rapeseed by 15.8%, and the yield reduction of serious fields can reach more than 50%. Weed damage areas w...
Examples
Embodiment 1
[0039] Example 1 Construction of cytosine base editing vector
[0040] The cytosine base editing vector pCBE-Bn suitable for dicotyledonous plants such as rape provided by the present invention is constructed based on the pCAMBIA1300 vector ( figure 1 ). First, we synthesized the DNA sequence (as shown in SEQ ID NO: 1) at Shanghai Sangon Biotech, including U6 promoter, sgRNA expression cassette, ubiqintin1 promoter, nos terminator and other elements. The pCAMBIA1300 vector was digested with HindIII and Acc65I, and then the digested vector was ligated with the synthetic DNA sequence to obtain an intermediate vector. Using rice base editing vector pH-nCas9-PBE (Addgene: #98164) as template, B-NcoI-F (GAAACACAAA CCATGC CAAAGAAGAAGAGGAAGGTT) and BE-BamHI-R (CGATCAATCA GGATCC CTACACCTTCCGCTTCTTCTTTG) is a primer to amplify the rAPOBEC1-nCas9-UGI element sequence therein. The intermediate vector was digested with BamHI and NcoI and the rAPOBEC1-nCas9-UGI amplified fragment was...
Embodiment 2B
[0042] Example 2 Construction and genetic transformation of BnALS1 editing vector
[0043] The sequence information of the wild-type BnALS1 gene was obtained from the European winter rape variety Darmor-bzh reference genome database (http: / / www.genoscope.cns.fr / brassicanapus / ). Combining the known herbicide resistance site information and the target site information designed by CRISPR-P2.0 software (http: / / crispr.hzau.edu.cn / CRISPR2 / ), it was found that there is a suitable one at the Pro197 site Target site AGGTCCCTCGCCGGATGAT.
[0044] By synthesizing the following primers sgRNA-F and sgRNA-R with adapters and annealing, the rapeseed base editing vector obtained in Example 1 was digested with BsaI, and then the target site was ligated into the sgRNA by conventional fragment carrier ligation expression cassette. The specific method is as follows:
[0045] (1) Primer sequence:
[0046]
[0047] (Deepened bases are linker sequences)
[0048] (2) Primer annealing:
[004...
Embodiment 3
[0081] Positive identification and edit detection of embodiment 3 tissue culture seedlings
[0082] After the regenerated seedlings of Example 2 were transplanted into the soil for normal production, the young leaves were taken to extract genomic DNA using the 2% CTAB method. Subsequent PCR positive detection was performed using vector-specific primers M13F (GGTAACGCCAGGGTTTTCC) and sgRNA-R2 (GCCATTTGTCTGCAGAATTG). A total of 217 positive plants were found in 230 tissue culture seedlings, and the positive rate was 94.3%. It shows that the rapeseed transgenic system used in the present invention is relatively perfect.
[0083]Then we performed editing detection on the obtained positive plants. Use BnALS1-specific primers WJP198F (TCGACAAGAACAAGACTTTCG) and WJP 198R (CACGGTCATCAAACCTAACAC) to carry out PCR amplification, and then the amplified products are directly subjected to Sanger sequencing. According to the sequencing profile, we found that a total of 7 plants of the T0...