Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

57 results about "Sequence types" patented technology

There are six sequence types: strings, Unicode strings, lists, tuples, buffers, and xrange objects.

System and method for pattern recognition in sequential data

The present invention is based on the encoding of sequential data or sequences in a novel manner that permits efficient storage and processing of sequential data, as well as methods for searching sequences or databases of sequences. The methods and systems of the current invention may be adapted broadly to various fields of application and to a variety of sequences types. For example, the current invention has broad application including to the fields of bioinformatics, molecular biology, pharmacogenomics, phonetic sequences, lexicographic sequences, signal analysis, game playing, law enforcement, biometrics, medical diagnosis, equipment maintenance and micro-array data analysis.
Owner:ELORET CORP

Method to generate semantically valid queries in the XQuery language

A computer implemented method, apparatus, and computer usable program code for automatically generating a query. Data and occurrence is described using a sequence type. The data and occurrence from the sequence type are matched to a sequence type pattern. Sentences in a query language are generated automatically using the sequence type pattern for testing an ability of a query processing engine to interpret queries.
Owner:TWITTER INC

Effectively and efficiently supporting XML sequence type and XQuery sequence natively in a SQL system

Techniques for effectively and efficiently supporting XML sequence type and XQuery sequence natively in a SQL system are described. According to one aspect, SQL functions that correctly handle XML sequences are provided. Thus, XML sequences are handled effectively. According to another aspect, rules for simplifying an abstract syntax tree (AST) that represents one or more such SQL functions are provided. For each such SQL function that is represented in an AST that represents a SQL query, one or more rules that are relevant to that SQL function are determined. Relevant rules are applied to the representation of the SQL function within the AST. Through the application of the rules to the representations of the SQL functions within the AST, the AST is modified in a manner that simplifies the AST prior to the evaluation of the AST at query execution time. Thus, XML sequences are handled efficiently.
Owner:ORACLE INT CORP

System and method for pattern recognition in sequential data

The present invention is based on the encoding of sequential data or sequences in a novel manner that permits efficient storage and processing of sequential data, as well as methods for searching sequences or databases of sequences. The methods and systems of the current invention may be adapted broadly to various fields of application and to a variety of sequences types. For example, the current invention has broad application including to the fields of bioinformatics, molecular biology, pharmacogenomics, phonetic sequences, lexicographic sequences, signal analysis, game playing, law enforcement, biometrics, medical diagnosis, equipment maintenance and micro-array data analysis.
Owner:ELORET CORP

System and method for detection of HLA Variants

A method for detecting one or more HLA sequence types is described that comprises the steps of: amplifying a plurality of first amplicons from a double stranded nucleic acid sample, wherein the first amplicons are amplified with a plurality of pairs of nucleic acid primers that define exons 2 and 3 of both strands of HLA loci from the group consisting of HLA-A, HLA-B, and HLA-C; amplifying the first amplicons to produce a plurality of populations of second amplicons, wherein each population of second amplicons is clonally amplified from one of the first amplicons; sequencing the plurality of populations of second amplicons to generate a nucleic acid sequence composition for each of the plurality of second amplicons; and detecting variation in the sequence composition from one or more of the second amplicons for one or more of the HLA loci.
Owner:454 LIFE SCIENCES CORP

Method to generate semantically valid queries in the xquery language

A computer implemented method, apparatus, and computer usable program code for automatically generating a query. Data and occurrence is described using a sequence type. The data and occurrence from the sequence type are matched to a sequence type pattern. Sentences in a query language are generated automatically using the sequence type pattern for testing an ability of a query processing engine to interpret queries.
Owner:TWITTER INC

Robot apparatus, and behavior controlling method for robot apparatus

A robot (1) is provided which includes a situated behaviors layer (SBL) (58). This SBL (58) is formed in the form of a tree structure in which a plurality of schemata (behavior modules) is connected hierarchically in such a matter that the schemata are highly independent of each other for each of them to behave uniquely. A patent schema can define a pattern in which child schemata are connected, such as an OR type pattern in which the child schemata are caused to behave uniquely, AND type pattern in which the plurality of child schemata are caused to behave simultaneously or a SEQUENCE type pattern indicating a sequence in which the plurality of child schemata should behave, thereby permitting to select a behavior pattern of the robot (1). Also, a new child schema can additionally be included in the SBL (58) without having to rewrite the schemata connection in the tree structure, whereby a new behavior or function can be added to the robot (1). Namely, the plurality of behavior modules permits to enable the robot (1) to show a complicated behavior and have units thereof recombined.
Owner:SONY CORP

Method and magnetic resonance apparatus for generating a measurement sequence executable by apparatus hardware

In a method and magnetic resonance apparatus for generation of a measurement sequence that can be executed with the hardware of the magnetic resonance apparatus, a measurement sequence is generated as a series of time slices of different time slice types, with the control signals for the magnetic resonance apparatus during each time slice being determined using parameters describing these time slices. After division of the measurement sequence into a number of time slices dependent on the sequence type and on a k-space sampling type, descriptive variables are associated with the time slices. Value ranges of the variables are limited and / or the variables are set in relation to one another using boundary conditions. A determination ensues of solution values of the variables with which a predetermined target parameter of the measurement sequence is optimized. A measurement sequence executable on the hardware is attained by association of the solution values with the corresponding parameters of the time slices.
Owner:SIEMENS HEALTHCARE GMBH

Summary generating apparatus, summary generating method and computer program

A summary generating apparatus includes; a text storage device storing text with information indicating a portion to be focused on; word vector converters vectorizing each word of the text and adding an element indicating whether the word is focused on or not to the vector and thereby converting the text to a word vector sequence; an LSTM implemented by a neural network performing sequence-to-sequence type conversion, pre-trained by machine learning to output, in response to each of the word vectors of the word vector sequence input in a prescribed order, a summary of the text consisting of the words represented by the word sequence; and input units inputting each of the word vectors of the word vector sequence in the prescribed order to the neural network.
Owner:NAT INST OF INFORMATION & COMM TECH

Method for selecting rach freamble sequence for high-speed mode and low-speed mode

A method for selecting a RACH preamble sequence for a high-speed mode and a low-speed mode is disclosed. In the case of acquiring sequence-type information to be used by a specific UE contained in a high-mobility region, a signaling reanalysis method under a general circular shift condition is disclosed, and a method for acquiring sequence-type information via the signaling using the sequence set configured by a restricted circular shift condition is also disclosed. Finally, a method for constructing a sequence set is disclosed.
Owner:LG ELECTRONICS INC

Method and magnetic resonance apparatus for generating a measurement sequence executable by apparatus hardware

In a method and magnetic resonance apparatus for generation of a measurement sequence that can be executed with the hardware of the magnetic resonance apparatus, a measurement sequence is generated as a series of time slices of different time slice types, with the control signals for the magnetic resonance apparatus during each time slice being determined using parameters describing these time slices. After division of the measurement sequence into a number of time slices dependent on the sequence type and on a k-space sampling type, descriptive variables are associated with the time slices. Value ranges of the variables are limited and / or the variables are set in relation to one another using boundary conditions. A determination ensues of solution values of the variables with which a predetermined target parameter of the measurement sequence is optimized. A measurement sequence executable on the hardware is attained by association of the solution values with the corresponding parameters of the time slices.
Owner:SIEMENS HEALTHCARE GMBH

Gradient resolved information platform

The invention provides improved methods and devices for the detection and identification in a sample of one or more target molecules which bind to probe molecules, particularly to nucleic acid probe molecules. The improved method is based on contacting the sample with a surface that is coated with one or more gradients of probe molecules, particlarly nucleic acid or nucleic acid analog probe molecules that serve to bind target molecules in the sample, particularly nucleic acids having sequences that are complementary or partially complementary to one or more probe molecules. A probe gradient generated on the surface is formed by the variation of a physical, structural or functional property of the probes on the surface. The gradient is generated, e.g., by varying density of probe molecules bound to the surface, by varying probe sequence length, by varying probe sequence, by varying probe sequence type, by varying the orientational structure of probes, and by varying the concentration of label associated with probes. Determination of the location, speed and / or extent of hybridisation of a nucleic acid on such a gradient surface is useful to identify target molecules bound to probes and / or to quantitatively measure the amount of the target in a sample. Hybridisation of target molecules to a gradient of nucleic acid probe can be examined as a function of time and / or hybridisation conditions (e.g., temperature, salt concentration, etc.) The methods and devices of this invention employ gradient surfaces to bind to one or more target molecules, particularly nucleic acids (or target sequences) in a sample, detecting their presence in the sample and quantitating the amount of one or more of such targets in a sample.
Owner:KRULL ULRICH J

Online optimal shearing method for defective steel plates

The invention relates to an online optimal shearing method for defective steel plates. The shearing method is characterized in that areas of a mother plate are divided, and at least one sub-plate is divided in each mother plate area, so that coordinates of a defect position on a rolling big plate are searched; edge coordinates of all the mother plate areas are inquired, so that the mother plate areas in which defects are distributed can be determined; different shearing strategies are formulated for sequence-type A group plates, partition-type S group plates and flame-cutting type G group plates; and all the defective sub-plates are avoided. In this way, the yield rate of the defective steel plates can be increased, and the feeding cost can be reduced. The method solves the problems in the prior art that the steel plate becomes shorter during shearing if the defect position is far from the head and tail of the rolling big plate; a lot of scrap plates can be generated; defects cannot be processed effectively; and the yield rate of the steel plates is greatly reduced.
Owner:BAOSHAN IRON & STEEL CO LTD

Bus arrival time prediction method based on GRU neural network

The invention discloses a bus arrival time prediction method based on a GRU neural network. The method comprises: outputting historical data from a database to a CSV format file, acquiring original data, and analyzing the original data by using an HBase distributed database and a Spark memory processing technology to remove hybridity, complexity and coefficient of the original data; on the basis of single attributes and a multi-factor perspective, analyzing and processing the processed original data by using a feature correlation research method to obtain standard time sequence type data; withthe Lasso method, carrying out variable selection on the standard time sequence type data, and rejecting a feature vector with weak correlation in the standard time sequence type data; and constructing a bus arrival prediction model based on a GRU neural network and inputting the standard time sequence type data with the feature vector with weak correlation rejected to the arrival prediction model, thereby realizing bus arrival time prediction operation. Therefore, the accuracy of the bus arrival time prediction is improved effectively.
Owner:NANTONG UNIVERSITY

Simulated Post-Contrast T1-Weighted Magnetic Resonance Imaging

A system and method for generating simulated post-contrast T1-weighted magnetic resonance (MR) images without the use of exogenous contrast material based upon patient-specific non-contrast MR images using machine learning / artificial intelligence techniques to train the system to generate post-contrast T1-weighted magnetic resonance images based upon retrospectively collected non-contrast MR images of various sequence types including T1-weighted, T2-weighted, FLAIR (Fluid-Attenuated Inversion Recovery), and / or DWI (Diffusion-Weighted Imaging).
Owner:IMAGING BIOMETRICS

Method and system of data exchange and deserialization method

The invention discloses a method of data exchange. The method of data exchange includes a data source terminal serializing an original data with a data exchange mode of Protobuffer to obtain a binary stream, an application terminal obtaining and parsing the serialized binary stream to obtain the type characteristic bits in the binary stream, determining the sequence type of the binary stream according to the type characteristic bits, and performing corresponding deserialization process to the binary stream according to the obtained sequence type to obtain the original data. The invention also discloses a data exchange system and a deserialization method. According to the methods and system of data exchange and deserialization method, the application flexibility of the deserialization can be improved and the application range of deserialization can be broadened.
Owner:BEIJING FEINNO COMM TECH

Adapting method between different byte sequence styles in network communication

This invention discloses an adapting method among different syllable sequences in network communication, which includes four steps: arranging the flat roof syllable sequence type information before and behind the adapting, obtaining data needed adapting, transforming syllable sequence according to the related information, providing the adapted data.
Owner:HUAWEI TECH CO LTD

Driving method of liquid crystal display

InactiveCN103258507AEnsure costEnsure display qualityStatic indicating devicesLiquid-crystal displayFrame time
The invention provides a driving method of a liquid crystal display. The driving method includes the following steps of in the first picture frame time, starting a first light source and supplying gray scale data of a first picture frame to a liquid crystal display panel, in the second picture frame time, starting a second light source and supplying gray scale data of a second picture frame to the liquid crystal display panel, in the third picture frame time, starting the first light source, the second light source and a third light source and supplying gray scale data of a third picture frame to a liquid crystal display panel. By means of the driving method of the liquid crystal display, a color separation phenomenon of a color sequence type liquid crystal display.
Owner:HANNSTAR DISPLAY CORPORATION

Method for transmitting srs in wireless communication system and terminal therefor

A method for transmitting a sounding reference symbol (SRS) by a terminal in a wireless communication system may comprise the steps of: receiving, from a base station, SRS configuration information including information indicating an SRS sequence type for generation of an SRS sequence of the terminal; generating the SRS sequence on the basis of the indicated SRS sequence generating type; and transmitting an SRS, to which the generated SRS sequence has been applied, from a corresponding resource to the base station.
Owner:LG ELECTRONICS INC

System and method for sending sequence type data

The invention relates to a system and a method for transmitting sequential data. The method comprises the following steps: receiving a data storage request sent by a thread to an application server, inserting the data storage request into the end portion of a sequential data transmitting management queue, sending the data storage request corresponding to a first element in the sequential data transmitting management queue to the application server and deleting the first element in the queue, moving forward other elements in the sequential data transmitting management queue one storage location in turn, and storing the data corresponding to the first element through the application server in the sequential data transmitting management queue in a database. When adopted, the sequential data transmitting system and method can reduce database connection number at one time.
Owner:北京盛世宝文化科技有限公司

Pepper and tomato bacterial streptomyces scabies MLST molecular typing method

The invention discloses a pepper and tomato bacterial streptomyces scabies MLST molecular typing method, and discloses a multilocus sequencing typing (MLST) method for the first time. The method is an operation technology for molecular typing on pepper and tomato bacterial streptomyces scabies. The method comprises the following steps: extracting DNA of genome of pathogenic bacteria, and screening, amplifying, detecting and sequencing seven house-keeping genes; carrying out multi-sequence comparison and analysis on a sequencing result by DNAMAN software to obtain a bacterial strain sequence type; and analyzing the sequence type by using an eBURSTV3 program in an online manner, so that four kinds of pathogenic bacteria can be distinguished effectively. Combination of the seven house-keeping genes and amplification primers which are used in the typing technology are used for the first time, and a PCR reaction system and conditions are optimized voluntarily. The technique process can be used for classification, identification and genetic diversity research of the pepper and tomato bacterial streptomyces scabies.
Owner:HUNAN AGRICULTURAL UNIV

Burst frame header detection method and system based on cyclic sequence type lead code

ActiveCN111541515AGood anti-frequency offset performanceImprove recognition rateReceiver specific arrangementsAlgorithmSelf correlation
The invention provides a burst frame header detection method and system based on a cyclic sequence type lead code. The method comprises the following steps: configuring the length and cycle index of alocal training sequence; starting frame header monitoring; receiving data after monitoring the frame header; performing segmented cross-correlation operation and accumulation on the received data anda local training sequence; and judging whether the accumulated value is greater than a threshold: if so, indicating that the data frame arrives, otherwise, continuing to receive data. According to the method, the advantages of self-correlation and cross-correlation of the training sequence are combined, so the method not only has good frequency offset resistance, but also has high recognition rate for burst frame header detection under the condition of low signal-to-noise ratio; meanwhile, the complexity of calculation is not increased. Compared with an existing cross-correlation detection mode, the method has the advantages that local correlation and signal autocorrelation can be detected, and the detection accuracy is higher.
Owner:北京中宸微电子有限公司

Method and system for automatically building database in item analysis process

The invention discloses a method for automatically building a database in an item analysis process. The method includes the steps of building items each comprising a plurality of sub-items, and storing the items to a business management system; if the sub-items are standard sub-items, sequencing samples corresponding to the sub-items by a sequencer, creating a standard process analysis for each sample, and during creation of each standard process analysis, allowing a user to select the built database and input corresponding comparison parameters into the database according to current sample conditions of the sub-items, sequencing types and analysis aims; after the sequencer finishes sequencing, filtering each sample datum according to the comparison parameters in the database to remove the sample data not confirming to the comparison parameters; analyzing each sample datum confirming to the comparison parameters, by means of the created standard process analysis so as to generate analysis results.
Owner:BGI TECH SOLUTIONS

Separation and application of pseudomonas with significant antagonism to plant pathogenic bacteria

The invention belongs to the field of microorganisms, and relates to separation and application of pseudomonas with significant antagonism to plant pathogenic bacteria. The strain XQ10 is separated from tobacco rhizosphere. An API 20 NE parenteral gram-negative bacillus identification result shows that XQ10 belongs to pseudomonas; 16S rRNA and multilocus sequence typing analysis based on gyrB, rpoB and rpoD show that the strain XQ10 belongs to pseudomonas but has a large difference from reported strains in pseudomonas, the strain XQ10 is regarded as a new strain which is not reported yet, and thus the strain is named Pseudomonas shandongensis XQ10. An antagonistic experiment shows that the strain has a significant inhibition effect on various plant pathogenic bacteria.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Method for realizing multi-site sequence molecular typing on haemophilus parasuis

InactiveCN108642192AFast and efficient result feedbackImproved Breeding StrategiesMicrobiological testing/measurementMicroorganism based processesMulti siteGenetic diversity
The invention discloses a method for realizing multi-site sequence molecular typing on haemophilus parasuis. According to the method, the operation technology of carrying out molecular typing on the haemophilus parasuis by adopting the multi-site sequence typing (MLST) method is disclosed for the first time. In the method, the genome DNA of the pathogenic bacteria is extracted, 7 house-keeping genes including rpoB, atpD, g3pd, infB, mdh, _6pgd and frdB are adopted for carrying out screening, amplification, detection and sequencing, CExpress and DNAMAN software is adopted for carrying out splicing, multi-sequence alignment and analysis on the sequencing result, and then the sequence type (ST) of the strain is obtained through an on-line haemophilus parasuis MLST typing database. The amplification primers used by the typing technology are adopted for the first time, the PCR reaction system and conditions automatically optimized, and the technique process can be used for the classification identification and genetic diversity research of haemophilus parasuis.
Owner:SOUTH CHINA UNIV OF TECH

Constitutive expression promoter in escherichia coli and applications in escherichia coli

The invention relates to a DNA for constitutive expression promoter Pinv in escherichia coli, which has information of SEQ ID NO.1. The sequence information is NO.:1, the sequence length is 51 base pairs, the sequence type is nucleic acid, the chain type is double chain, the topology is linearity, the molecule type is gene group DNA, the hypothesis is NO, the antisense is NO, the source is soil-uncultured microorganism and the sequence is aacattgaggcaacgacaaggtcgattctgctatccttgaggaggctcctc. The promoter can realize the high-level expression of foreign gene in the escherichia coli without induction of chemical and physical conditions. The obtained promoter can be used for expressing the foreign gene in the escherichia coli and can be used for production of protein.
Owner:GUANGXI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More