Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof

A technology of genetically modified rice and detection kit, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, can solve problems such as complicated operation, and achieve the effect of simple and easy method and obvious advantages.

Inactive Publication Date: 2009-01-14
CHINA NAT RICE RES INST
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this method, the concentration of different primers is different, and the span is from 0.2 to 1.5uM. The PCR results are analyzed by 6% polyacrylamide gel electrophoresis and silver staining techniques. The actual operation is cumbersome and can only detect Cry l in the Bt poisonous protein gene Ab, an exogenous insect resistance gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof
  • Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof
  • Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] 1. Synthesis of PCR primers:

[0110] According to the CaMV 35s and Bt primer sequences provided by the Ministry of Agriculture Announcement-6-2007, the Nos primer sequence provided by the national standard GB / T19495.4-2004, the Cpti primer sequence provided by He Longfei et al. Primers were designed for the sequence of the 122-966 region of the mycin-resistant Hpt gene, and were commissioned to be synthesized by Shanghai Yingjun Company. The primer sequence information is shown in Table 1:

[0111] Table 1

[0112] Primer

name

Sequence (5'-3')

target fragment size

bp

CaMV

35s

CaMV-F: GCTCCTACAAAATGCCATCA

CaMV-R: GATAGTGGGATTGTGCGTCA

195

nos

nos-F: CATGACGTTATTTATGAGATGGG

nos-R: GACACCGCGCGCGATAATTTATCC

118

Bt

Bt-F: GAAGGTTTGAGCAATCTCTAC

Bt-R: CGATCAGCCTAGTAAGGTCGT

301

Cpt

Cpti-F: AAA ATG ...

Embodiment 2

[0136] Example 2: Detection of transgenic insect-resistant rice with different template concentrations using multiplex PCR technology

[0137] 1. Synthesize primers and extract the DNA of transgenic rice II Youkefeng 6 and its receptor II Youming 86 according to the method described in Example 1, and measure the DNA concentration to be 400ng / uL;

[0138] 2. Dilute the sample DNA to 200, 100, 50, 25 ng / uL in proportion with TE buffer;

[0139] 3. Perform 3-fold PCR reaction according to step 3.1 of Example 1, the PCR buffer concentration is 2.0×, and the primer concentration is 0.2uM;

[0140] 4. Carry out electrophoresis and analysis according to step 4. For the electrophoresis results, see Figure 4 .

[0141] Note: Swimming lanes 1 to 5 are template DNA concentrations of 400, 200, 100, 50, and 25 ng / uL respectively; Swimming lane 6 is a negative control.

[0142] Conclusion: From picture 4, it can be concluded that the minimum template concentration that triple PCR can de...

Embodiment 3

[0143] Example 3: Using multiplex PCR technology to detect the content of different genetically modified components

[0144] 1. Synthesize primers according to the method described in Example 1 and extract the DNA of transgenic rice II Youkefeng No. 6 and its receptor II Youming 86 with a transgene content of 1.0% and 0.1% respectively, measure the DNA concentration and use TE buffer solution to The extracted sample DNA was diluted to 200ng / uL.

[0145] 2. Carry out 3-fold PCR reaction according to step 3.1 of Example 1, the concentration of PCR buffer is 2.0×, the concentration of primer is 0.2uM, and 2.0uL and 5.0uL of template DNA are added respectively;

[0146] 3. Carry out electrophoresis and analysis according to step 4, see the results Figure 5 . Note: Swimming lane 12 is a sample with 1.0% transgenic rice content, and the template addition amount is 2.0uL; Swimming lane 13 is a sample with 0.1% transgenic rice content, and the template addition amount is 2.0uL; Swi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a multiple PCR detection reagent kit for insect-resistant transgene paddy rice and a detection method thereof. The multiple PCR detection reagent kit mainly comprises the following primer sequences: CaMV-F: GCTCCTACAAATGCCATCA, CaMV-R: GATAGTGGGATTGTGCGTCA, Nos-F: CATGACGTTATTTATGAGATGGG, Nos-R: GACACCGCGCGCGATAATTTATCC, Bt-F: GAAGGTTTGAGCAATCTCTAC, Bt-R: CGATCAGCCTAGTAAGGTCGT. The invention mainly has the advantages that the existing domestic insect-resistant transgene paddy rice can be quickly and accurately detected only through one-time PCR, and the sensitivity can reach 0.1 percent; moreover, the cost is low, the accuracy rate is high, and the false positive rate is low.

Description

(1) Technical field [0001] The invention relates to a multi-PCR detection kit and detection method for transgenic rice capable of simultaneously detecting 3 to 4 insect-resistant exogenous genes. (2) Background technology [0002] Rice is one of the most important food crops. Since the first batch of transgenic rice plants came out in 1988, China, Japan, Thailand, Germany, the Philippines, Switzerland, the United Kingdom, the United States, Canada and other countries have made a series of achievements in the field of rice transgenic research, and many transgenic rice varieties have entered the field Experiments, and continue to develop in the direction of practicality. my country's transgenic technology is developing rapidly. Among them, rice transgenic technology is one of the few internationally competitive transgenic technologies in my country, and has attracted much attention. Many transgenic rice materials have been approved for environmental release, including 4 insec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 王渭霞傅强赖凤香
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More