Method for preparing live bacteria internal standard based on gene substitution technique

A technology of gene replacement and live bacteria, which is applied in the field of preparation of live bacteria internal standards, to improve accuracy and avoid false negative effects

Active Publication Date: 2009-04-01
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far there is no report about the application of live bacteria internal standard in microbial PCR detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing live bacteria internal standard based on gene substitution technique
  • Method for preparing live bacteria internal standard based on gene substitution technique
  • Method for preparing live bacteria internal standard based on gene substitution technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0032] 1. Design of homologous recombination fragments and corresponding enzyme cutting sites

[0033] 1. Selection of upstream homologous sequence (UHF) and design of restriction site

[0034] According to the hly gene and its upstream fragment sequence characteristics of Listeria monocytogenes, the upstream homologous sequence amplification primers and corresponding enzyme cutting sites (Kpn I, Sal I) were designed:

[0035] Amplification primers for upstream homologous sequences (Hlyku-s / Hlyku-a)

[0036] Hlyku-s: 5'- CTTGGTACCCGATGTACCGTATTCCCTG -3'

[0037] Hlyku-a: 5'- ATTGTCGACGGGTTTCACTCTCCTTCT -3'

[0038] (a) Sequence characteristics of upstream homologous sequences:

[0039] * Length: 551 bp

[0040] *Type: nucleic acid

[0041] * Chain type: double chain

[0042] *Topology: Linear

[0043] (b) Molecule type: DNA

[0044] (c) Original source: Listeria monocytogenes

[0045] (d) Sequence description: SEQ ID NO.1

[0046] CGATGTACCGTATTCCTGCTTCTAGTTGTTGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing internal standard of viable bacteria based on the gene substitution technology, which pertains to the field of biotechnology and comprises the steps: (1) the selection of homologous recombination sequences, amplification internal standard sequences and kanamycin-resistant gene sequences of double-exchange DNA and the design of corresponding enzyme-cutting sites are carried out between the upstream and the downstream and target genes in the gene substitution process; (2) homologous recombination plasmids pKSV7-UIKD containing the upstream and downstream homologous sequences, the internal standard sequences and the kanamycin-resistant gene are prepared; (3) the screening of electroporation-competent listeria monocytogenes of the homologous recombination plasmids and recipient cell transformant having donator properties after the corresponding electroporation is carried out; (4) the screening of viable listeria monocytogene internal standard which carries out gene substitution is carried out; and (5) the prepared amplification internal standard is verified by adding the viable bacteria internal standard in the samples to be detected and the like. The method avoids the occurrence of false negative phenomenon caused by the inhibiting ingredients, thus greatly improving the accuracy of microbial fluorescence quantitative PCR detection.

Description

technical field [0001] The invention relates to a method in the field of biotechnology, in particular to a method for preparing an internal standard of viable bacteria based on gene replacement technology that can be widely used in fluorescence quantification. Background technique [0002] Fluorescent quantitative PCR (abbreviation for real-time quantitative polymerase chain reaction) refers to: fluorescent quantitative polymerase chain reaction. Fluorescence quantitative PCR technology is a nucleic acid quantitative technology developed on the basis of ordinary PCR technology. It is a double-labeled fluorescent probe complementary to the target fragment sequence added to the ordinary PCR system. The 5' of the probe The end is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. When the probe is intact, the reporter group cannot produce fluorescence due to the effect of the quencher group; in PCR amplification, due to the 5...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N1/21C12R1/01
Inventor史贤明龙飞施春雷朱欣娜张忠明
OwnerSHANGHAI JIAO TONG UNIV