A method for differentiating and culturing monocytes into mature dendritic cells

A technology of dendritic cells and monocytes, applied in animal cells, vertebrate cells, blood/immune system cells, etc., can solve the problems of expensive transwell, expensive cytokines, long cell induction cycle, etc., to overcome Cultivate complex and unstable, optimize the culture system, and the effect of mass culture

Active Publication Date: 2014-10-22
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has a long cell induction cycle and expensive cytokines
In 2008, Brian C. Schanen used transwell technology (a kind of permeable cup-shaped device, which is often used in tumor invasion experiments, co-culture experiments, etc.) to combine peripheral blood mononuclear cells (PBMC) and human umbilical vein blood endothelial cells ( HUVEC) for co-culture, after PBMC pass through the upper layer of HUVEC, differentiate into immature DC in the lower layer, the whole differentiation process does not require exogenous cytokines, and is closer to the process of DC differentiation in vivo, but this culture method transwell price comparison Expensive and only suitable for small amount of culture (Brian C. Schanen and Donald R. Drake III. A novel approach for the generation of human dendritic cells from blood. Journal of Immunological Methods 2008, 335, 53-64)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for differentiating and culturing monocytes into mature dendritic cells
  • A method for differentiating and culturing monocytes into mature dendritic cells
  • A method for differentiating and culturing monocytes into mature dendritic cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Ea.hy926 cells secreting GM-CSF and IL-4, and TNF-α

[0031] 1. Establishment of lentiviral multi-gene co-expression vector

[0032] 1) Amplify GM-CSF-2A and 2A-IL4 sequences respectively.

[0033] 2A sequence forward primer: 5'-3'

[0034] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT

[0035] 2A sequence reverse primer: 5'-3'

[0036] AGGGCCGGGATTCTCCTCCACGTCACCGCATGTTAGAAGACTTCCTCTGCC CTC

[0037] 2) Amplify the fusion gene GM-CSF-2A-IL4.

[0038] 3) Amplify the IL2 signal peptide-sTNF-α.

[0039] 2) and 3) PCR amplification results see figure 1 ,exist figure 1 Among them, each lane is (1). GM-CSF-2A-IL4 overlapping PCR results; (2) IL2 signal peptide-sTNF-α; (3) molecular weight marker DL.marker2000. By polymerase chain reaction (PCR), 948bp of GM-CSF and IL4 co-expressed genes, and about 530bp of the target gene IL2 signal peptide-sTNF-α were obtained. The sequencing results were consistent with the sequence published by ...

Embodiment 2

[0064] Example 2 Preparation of feeder layer cells

[0065] 1) Infect Ea.hy926 cells with the above-mentioned lentivirus to obtain IL4, GM-CSF-Ea.hy926 feeder cells and TNF-α-Ea.hy926 feeder cells;

[0066] The infection steps are the same as those in Example 1 for infecting EA.hy926 cells with lentivirus;

[0067] 2) Using fluorescent cell sorting technology, sort out GFP strong expressing strains and weak expressing strains according to the intensity of GFP fluorescence;

[0068] 3) IL4, GM-CSF-Ea.hy926 and TNF-α-Ea.hy926 cells were irradiated with gamma rays at a dose of 40Gy to inhibit their proliferation, and the irradiated cells were replaced with medium, incubated in a cell culture box for 2-3h, PBS solution Wash and prepare feeder cells.

Embodiment 3

[0069] Example 3 PBMC and feeder layer cell co-culture

[0070] 1) Preparation of normal human peripheral blood PBMC (operated according to the instructions of the lymphocyte separation medium kit, human lymphocyte separation medium Product Number: LTS 1077, purchased from Haoyang Biotechnology Company, Institute of Bioengineering, Chinese Academy of Medical Sciences);

[0071] 2) Sorting peripheral blood CD 14 by immunomagnetic bead method + Monocytes (use Monocyte Isolation Kit II Order no.130-091-153 from Miltenyi, Germany, and isolate according to the instructions);

[0072] 3) After the GM-CSF and IL4-Ea.hy926 feeder cells adhere to the wall, inoculate PBMC cells, collect the suspended cells for 48 hours and inoculate them on the TNF-α-Ea.hy926 feeder layer cells, and collect the suspended cells after 24 hours

[0073] The cells are mature DCs.

[0074] Figure 7 To observe the morphology of DC cultured in vitro with an inverted microscope, by Figure 7 It can be seen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for differentiating and culturing CD 14<+> mononuclear cells into mature dendritic cells, which is characterized in that CD 14<+> cells and human umbilical vein endothelial cells capable of secreting cell factors for promoting cell maturity and differentiation are simultaneously cultured, so the CD 14<+> cells become the mature dendritic cells. Compared with the traditional method, the method has the characteristics and advantages that the method is economic, the speed is high, and the mass culture can be realized.

Description

technical field [0001] The present invention relates to a CD 14 + The invention relates to a method for differentiating and culturing monocytes into mature dendritic cells, belonging to the field of cell biology. Background technique [0002] Dendritic cells (Dendritic cells, DC) were first isolated from mouse lymphoid organs by Steinman and Cohn in 1973. It is the most powerful and the only professional antigen-presenting cell (Antigen-presenting cell, APC) that can activate naive T cells (NT cells) and plays a central role in the immune response. In recent years, DC-based immunotherapy has become a research hotspot, especially in vitro large-scale expansion and culture of DC for virus infection and tumor treatment has entered the clinical trial stage. [0003] DC derived from bone marrow CD34 + The cells are widely distributed in all organs of the body except the brain, but the number is extremely small, accounting for less than 0.5-1% of peripheral plaque mononuclear c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N5/0786
Inventor于群石晓月李伟静王璇琳贺敏乔志新冯秋月程宏张公庆王婧杨晓琮
OwnerFIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY