Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB)

A kit and gene technology are applied in the field of kits for detecting the A746G site of the sheep BMPR-I B multiple-fetal gene, and can solve the problems of insufficiently lysed hair follicle cells, cumbersome operation process, complicated operation and the like.

Inactive Publication Date: 2012-10-31
XINJIANG AGRI UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few inventions related to kits and methods for detecting the A746G mutation site of BMPR-IB gene. For the invention and method of BMPR-IB gene detection, the means of obtaining DNA are basically extraction tests through phenolic extraction. DNA in animal blood is realized, but the operation process of the conventional phenolic extraction method is relatively cumbersome, and it needs to be digested with proteinase K for a long time, and genomic DNA will be lost in the multi-step operation, and the whole detection process is relatively long. And the reagents such as phenol imitate used are unfavorable to the operator's health
[0005] The extraction of high-quality genomic DNA is an important basis for subsequent molecular biology research. It is relatively easy to obtain and the most commonly used materials are animal blood, ear tissue, tail tissue or toe tips. Although the collection of these tissues will not cause animal death, However, it will cause more or less physical harm to animals and is prone to stress, especially for rare and protected animals with high economic value or endangered. Extracting animal hair is relatively simple and will hardly cause any harm to animals. Injury, in addition, hair is more convenient for long-term storage and long-distance transportation, does not require refrigeration, and does not require special treatment
[0006] There are also reports in the literature about the method of extracting DNA from hair: (1) Yu Jian et al. used phenol-chloroform repeated extraction method to extract a small amount of DNA from hair under the action of proteinase K (56 ° C), but the disadvantage is that the extracted DNA is small. less amount
(2) Xu Yanchun et al. and Wu Xinyao et al. used Chelex-100 to treat hair to prepare DNA. The DNA extracted from one hair can get good experimental results. However, this method is not thorough enough to lyse the hair follicle cells, and the residual digestive juice is harmful to subsequent The PCR process has some influence
Then, (3) Li Junlin et al. optimized on the basis of conventional phenol-chloroform extraction method, with pH8.8 Tris-HCl, MgCl 2 Solution and proteinase K are used to digest the lysate to obtain higher quality DNA, but the operation is complicated and time-consuming
(4) Zhao Chunjiang et al. improved on this basis, using commonly used PCR buffer, MgCl 2 solution and proteinase K as the lysate, and set a single-cycle program on the PCR instrument: 65°C for 30 minutes, 95°C for 15 minutes, and 4°C for 10 minutes, then centrifuge the PCR tube instantaneously, and the supernatant can be used as a PCR template. High digestion temperature (65°C) enables proteinase K to efficiently digest the protein in hair follicles in a short period of time, allowing the cells to release DNA; the Tris base contained in the PCR buffer and the pH of the PCR buffer can be adjusted in During the DNA extraction process, it can protect DNA and prevent degradation; on the PCR instrument, the process of 95°C for 15 minutes can inactivate proteinase K, preventing proteinase K from digesting Taq enzyme in the subsequent PCR process and making PCR amplification impossible. The method can be used to process a large number of specimens, and the effect is good, but the reagents used in this method are relatively expensive and need to be stored at -20°C

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB)
  • Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB)
  • Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0032] The kit for rapidly detecting the A746G locus of sheep BMPR-IB multifetal gene disclosed by the present invention includes the following hair sample DNA extraction solutions A and B, PCR amplification solution, restriction endonuclease Ava II, 10×Buffer R, ddH 2 O, dyes, instructions, the specific specifications are as follows:

[0033] Numbering

name

Specification (l / tube)

amount)

1

Hair sample DNA extraction solution A

1000

2

2

Hair sample DNA extraction solution B

1000

2

3

PCR amplification solution

1000

2

4

restriction endonuclease AvaII

1000

1

5

10×Buffer R

1000

1

6

dye

1000

2

[0034] 7

wxya 2 o

1000

2

8

manual

1

[0035] 1) Hair sample DNA extraction solution A

[0036] 1000μl of 175mM NaOH solution;

[0037] 2) Hair sample D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB). The kit comprises (1) dirty galley DNA extract A which is 175mM NaOH solution,(2) dirty galley DNA extract B which is 16.7 mu l 175mM HCl, 500 mu l 100mM Tris-HCl with the pH of 8.5, and 83.3 mu l ddH2O4, (3) PCR (polymerase chain reaction) amplification liquid which is 10.0 mu l 2xTaq PCR Master Mix, 7.7 mu l ddH2O, 0.4 mu l 10mM upstream primer and 0.4 mu l 10mM downstream primer, with the sequence of the upstream primer of the BMPR-IB gene of 5'GTCGCTATGGGGAAGTTTGGATG3' and the sequence of the downstream primer of 5'CAAGATGTTTTCATGCCTCATCAACACGGTC3',(4) 10 U / mu l restriction enzyme Ava II, (5) 10xBuffer R which is 100mM Tris-HCl, 100mM MgCl2, 1M KCl, 1mg / ml BSA, (6) dye which is 6xRNA / DNA Loading buffer,(7) ddH2Oband (8) a specification.

Description

technical field [0001] The invention relates to the technical field of molecular biology, and is especially suitable for a kit and a method for simply and rapidly extracting genomic DNA from sheep wool follicles, and then detecting the A746G site of the sheep BMPR-IB multifetal gene. Background technique [0002] Fec B The gene is the first major gene of high fecundity identified in sheep, and it was later proved that the gene is actually the BMPR-IB gene, which has been found in Australian Booroola Merino sheep, Indian Garole sheep, Indonesian Javanese sheep, and Chinese The A746G mutation site of BMPR-IB gene exists in Hu sheep, Small-tailed Han sheep, Chinese Merino sheep (Junken type), Chinese Merino sheep (Xinjiang type), Tan sheep, and Cele black sheep. The number of ovulation and the number of lambs have a significant effect, and it is one of the main genes controlling the number of lambs in sheep. [0003] Literature search disclosure: ① In November 2010, Guan Feng...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor刘武军邵勇钢王琼
OwnerXINJIANG AGRI UNIV