Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

59 results about "Bone morphogenetic protein 6" patented technology

Bone morphogenetic protein 6 is a protein that in humans is encoded by the BMP6 gene. The protein encoded by this gene is a member of the TGFβ superfamily. Bone morphogenetic proteins are known for their ability to induce the growth of bone and cartilage. BMP6 is able to induce all osteogenic markers in mesenchymal stem cells.

Cell model obtained after targeted knockout of rabbit bone morphogenetic protein-2 (BMP2) gene based on CRISPR/Cas9 and application thereof

The invention relates to a cell model obtained after targeted knockout of a rabbit BMP2 gene based on CRISPR / Cas9 and application thereof, belonging to the technical field of molecular biology and biomedicine. According to the invention corresponding oligos are synthesized for three targeting sites of the rabbit BMP2 gene on the design principles of CRISPR / Cas9 and are constructed on px458 vectors; and a CRISPR / Cas9 system is constructed directed at the three targeting sites in rabbit mesenchymal stem cells, and the CRISPR / Cas9 system can effectively knock out the rabbit BMP2 gene, is easy to operate and has high rabbit BMP2 gene knockout efficiency. The cell model disclosed in the invention can greatly promote research related to the functions and signaling pathways of the BMP2 gene.
Owner:QINGDAO JIAOZHOU CENT HOSPITAL

Bone Morphogenic Protein Binding Peptide

A cyclized peptide designated BMP Binding Peptide (BBP) is a synthetic peptide that avidly binds rhBMP-2. BBP increases the over-all osteogenic activity of rgBMP-2, increases the rate at which rhBMP-2 induces bone formation, and BBP induces calcification alone. Compositions and substrates including BBP, and methods of using BBP are useful in therapeutic, diagnostic and clinical applications requiring calcification and osteogenesis.
Owner:RGT UNIV OF CALIFORNIA +1

Detection method of nucleic acid

The present invention relates to an in vitro detection method that whether a sample contains target nucleic acid or not is detected by utilizing fusion protein of split-signaling morphogenetic protein and nucleic acid enzyme defect type Cas9 protein, a kit and a device.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI +1

Remedy

The present invention relates to a therapeutic agent or prophylactic agent for a disease requiring enhancement of bone morphogenetic protein production or promotion of osteogenesis; an agent for enhancement of bone morphogenetic protein production or an agent for promotion of osteogenesis, a food, beverage or feed for enhancement of bone mornhogenetic protein production or promotion of osteogenesis, characterized in that each comprises as an effective ingredient at least one compound selected from the group consisting of (a) an acidic saccharide, (b) a polyacrylic acid, (c) chlorogenic acid and (d) an oxidation processed product of chlorogenic acid, or an extract derived from algae.
Owner:TAKARA HOLDINGS

BMP Mutants with Decreased Susceptibility to Noggin

The present invention provides modified, highly potent bone morphogenetic proteins. In particular, the present invention relates to the observation that BMP-6 and BMP-9 are less susceptible to inhibition by Noggin that are other members of the BMP subfamily of proteins. The present invention features chimeric bone morphogenetic proteins in which the middle portion of BMP-6 or BMP-9 replaces the middle portion of another BMP subfamily protein to cause resistance to inhibition by Noggin or other Noggin-like antagonists. Other embodiments of modified BMPs, compositions and methods of use are also included.
Owner:MARIEL THERAPEUTICS

Macromolecular conjugates of bone morphogenetic protein-7

A modified bone morphogenetic protein (BMP, also referred to as bone morphogenic protein) composition is described. The bone morphogenetic protein, in one embodiment, is BMP-7 which is chemically modified with a hydrophilic polymer, such as poly(ethylene glycol).
Owner:ALZA CORP

Buffers for Controlling the pH of Bone Morphogenetic Proteins

The present invention provides formulations of cysteine knot proteins, including TGF-β superfamily proteins and bone morphogenic proteins that are pH stabilized. In particular, the present invention relates to the observation that certain buffers enhance the stability of cysteine knot proteins, including TGF-β superfamily proteins and bone morphogenic proteins. In particular, disclosed herein are liquid and lyophilized formulations prepared with a glycylglycine and tartaric acid buffers to stabilize the pH of the formulation.
Owner:STRYKER CORP

BMP Mutants with Decreased Susceptibility to Noggin

The present invention provides modified, highly potent bone morphogenetic proteins. In particular, the present invention relates to the observation that BMP-6 and BMP-9 are less susceptible to inhibition by Noggin that are other members of the BMP subfamily of proteins. The present invention features chimeric bone morphogenetic proteins in which the middle portion of BMP-6 or BMP-9 replaces the middle portion of another BMP subfamily protein to cause resistance to inhibition by Noggin or other Noggin-like antagonists. Other embodiments of modified BMPs, compositions and methods of use are also included.
Owner:MARIEL THERAPEUTICS

Application of bone morphogenetic protein 4 in cancer inhibition

The present invention relates to an application of bone morphogenetic protein 4 in cancer inhibition. Specifically bone morphogenetic protein (BMP) has a liver cancer stem cell differentiation induction effect, wherein CD133 protein expression of liver cancer cell lines can be down-regulated and liver cancer cell line CD133+ liver cancer stem cell differentiation can be promoted with BMP4, and BMP4 can further be provided for inhibiting in vitro proliferation and self-renewal of liver cancer cell lines and inhibiting tumorigenicity of immune-deficient mice. The present invention further provides BMP4-induced liver cancer stem cell differentiation action mechanism.
Owner:SHANGHAI INST OF ONCOLOGY

CHO cell strain capable of stably and efficiently expressing recombinant human BMP7 (bone morphogenetic protein-7) and medical application

The invention provides a CHO cell strain capable of stably and efficiently expressing recombinant human BMP7 (bone morphogenetic protein-7) and a medical application. A bmp7 gene sequence is constructed by modifying a bmp7 gene of a mouse, a CHO cell serving as a host is also derived from the mouse, the genetic compatibility and the translation efficiency are greatly improved, the defect that gene sequence templates of BMP7 protein expressed by a CHO system are all derived from human bmp7 genes in the prior art is overcome, and the situation that human-sourced gene sequences are difficult to transcribe and translate efficiently by CHO cells due to codon preference is avoided; meanwhile, the adopted CHO-S cells are suspension cultured cells which have been adapted to a serum-free culture medium, the cell strain does not need to be subjected to suspension acclimation, and the engineering CHO cell strain can keep the stability conveniently. The adopted technical means has a remarkable efficiency improvement function in key steps of BMP expression as follows: transcription, translation, folding, conditioned cleavage, secretion, pairing of disulfide bonds and glycoform modification of glycosylation sites.
Owner:长春生物制品研究所有限责任公司

Methods of using bone morphogenic proteins as biomarkers for determining cartilage degeneration and aging

Methods are provided for determining cartilage degeneration, regeneration, or aging in a joint tissue in a patient by measuring levels of osteogenic protein-1 (OP-1) protein and / or mRNA in synovial fluid or joint tissue. The methods according to the invention are useful for detecting, diagnosing, predicting, determining a predisposition for, or monitoring joint tissue degeneration, regeneration, or aging in a patient including inflammatory joint disease or age-related disorders.
Owner:RUSH PRESBYTERIAL ST LUKES MEDICAL CENT +1

Inducing method and inducing liquid of mesenchymal stem cells

The invention relates to an inducing method of mesenchymal stem cells. The inducing method includes: obtaining the mesenchymal stem cells for in-vitro culture; using inducing liquid for induction in the process of in-vitro culture, wherein the inducing liquid comprises angiotensin II and bone morphogenetic protein-2. The bone morphogenetic protein capable of promoting growth and differentiation of the mesenchymal stem cells and the angiotensin II capable of promoting proliferation of the mesenchymal stem cells are adopted as inducers to induce culture of the mesenchymal stem cells, so that too-early wall-removal apoptosis of the mesenchymal stem cells can be prevented, and activity of the mesenchymal stem cells can be improved while conversion rate of the same can be increased.
Owner:深圳华毓造血干细胞研究有限公司

Bone morphogenetic protein (bmp)-binding domains of proteins of the repulsive guidance molecule (rgm) protein family and functional fragments thereof, and use of same

The present invention relates to the identification and use of bone morphogenetic protein (BMP)-binding domains of members of the repulsive guidance molecule (RGM) protein family, and polypeptide fragments and fusion proteins derived therefrom. The domains, i.e., peptide fragments and fusion proteins, according to the invention are suitable as agents for the active or passive immunization of individuals, or as diagnostic and therapeutic agents for use for diseases or medical conditions in whose origin or progression a member of the RGM family and a cellular receptor associated with this molecule, such as neogenin and / or BMP in particular, is involved. The invention further relates to monoclonal and polyclonal antibodies directed against the binding domains according to the invention, and against the polypeptides derived therefrom, and to methods for producing the polypeptides, fusion proteins, and antibodies according to the invention.
Owner:ABBVIE DEUTSHLAND GMBH & CO KG

Method for inducing synovium mesenchymal stem cells to be differentiated to chondrocytes by in-vitro lentivirus mediated BMP-2 (Bone Morphogenetic Protein) genes

The invention relates to a method for inducing synovium mesenchymal stem cells (SMSCs) to be differentiated to chondrocytes by in-vitro lentivirus mediated BMP-2 (Bone Morphogenetic Protein) genes. The method comprises the following steps of: separating and culturing synovium mesenchymal stem cells; constructing a recombinant plasmid pFUGW-oBMP-2; preparing morbus virosus of transfected lentivirus; and transfecting synovium mesenchymal stem cells by the morbus virosus of transfected lentivirus, wherein in the step of preparing morbus virosus of transfected lentivirus, the transfected lentivirus is jointly formed by the recombinant plasmid pFUGW-oBMP-2 and a packaging plasmid; and in the step of transfecting synovium mesenchymal stem cells by the morbus virosus of transfected lentivirus, synovium mesenchymal stem cells over third generation is taken to be mixed with the morbus virosus of transfected lentivirus, and then added into incomplete chondroblast inducing culture liquid to induce so as to obtain chondrocytes. SMSCs transfected by the transfected lentivirus provided by the invention are safe enough and can be spontaneously differentiated to cartilage in vitro.
Owner:SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY

Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB)

The invention provides a kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB). The kit comprises (1) dirty galley DNA extract A which is 175mM NaOH solution,(2) dirty galley DNA extract B which is 16.7 mu l 175mM HCl, 500 mu l 100mM Tris-HCl with the pH of 8.5, and 83.3 mu l ddH2O4, (3) PCR (polymerase chain reaction) amplification liquid which is 10.0 mu l 2xTaq PCR Master Mix, 7.7 mu l ddH2O, 0.4 mu l 10mM upstream primer and 0.4 mu l 10mM downstream primer, with the sequence of the upstream primer of the BMPR-IB gene of 5'GTCGCTATGGGGAAGTTTGGATG3' and the sequence of the downstream primer of 5'CAAGATGTTTTCATGCCTCATCAACACGGTC3',(4) 10 U / mu l restriction enzyme Ava II, (5) 10xBuffer R which is 100mM Tris-HCl, 100mM MgCl2, 1M KCl, 1mg / ml BSA, (6) dye which is 6xRNA / DNA Loading buffer,(7) ddH2Oband (8) a specification.
Owner:XINJIANG AGRI UNIV

Expression of zebrafish bone morphogenetic protein 4

Embodiments of the invention generally provide isolated DNA molecules, tissue-specific expression sequences, and promoter and regulatory DNA sequences involved in the regulation of bone morphogenetic protein 4 (BMP4). More specifically, the invention relates to regulation of gene expression in a tissue-specific manner. In one aspect, the invention provides zebrafish BMP4 gene, its structural organization, its promoter, and proximal and distal regulatory regions. In another aspect, the invention provides methods for identifying potential compounds / agents, potential molecular regulators, and the expression pattern for the expression of BMP4 gene.
Owner:ACAD SINIC

Bone morphogenetic protein 3 and osteogenic devices and pharmaceutical products containing thereof

ActiveUS20100041595A1Increased expression of recombinantImproving and enhancing biological activityBacteriaPeptide/protein ingredientsBone formationBone morphogenetic protein 6
The present invention relates to reindeer bone formation inducing protein called bone morphogenetic protein 3c (BMP-3c), nucleotide molecules encoding the protein and host cells expressing the protein. The present invention relates also to the use of said BMP-3c for treating disorders related to bone and cartilage formation. Osteogenic devices and pharmaceutical compositions containing the protein are also disclosed.
Owner:BBS BIOACTIVE BONE SUBSTITUTES

Method for fixing bone morphogenetic protein-2 (BMP-2) with decalcified bone matrix

The invention discloses a method for fixing a bone morphogenetic protein-2 (BMP-2) with a decalcified bone matrix. By using the decalcified bone matrix prepared by the metaphysis of pork hind leg bones as an object, the method comprises the following steps of: loading a BMP-2 solution at the concentration of 1 mu g per mu L to the decalcified bone matrix; placing into a microwave synthesizer, and processing for 30 minutes at the microwave power of 500 watts and reaction temperature 37 DEG C to fix the BMP-2 on the decalcified bone matrix; and putting the decalcified bone matrix in a 3 percentchitosan solution for 5 minutes, then taking the decalcified bone matrix out, and drying at the temperature of 37 DEG C. By adoption of the method provided by the invention, the fixation and combination of the BMP-2 and the decalcified bone matrix are stable, a fixing effect is good, the release speed of the BMP-2 is reduced, and the utilization ratio of the BMP-2 is improved; and the method has a higher practical application value in the field of medicine.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof

The invention discloses production method and usage of nucleotide sequence of human bone morphological recombination protein9. A kind section of separate DNA that coding the nucleotides sequence of human bone morphological protein9. A kind of protein: mammalian cell and bacillus coli expression human bone morphological recombination protein9. A kind of vector: the nucleotide sequences that encode BMP-9 were inserted plasmid victor, when the plasmid victor amplification in mammalian cell or bacillus coli, the recombination BMP-9 can be expressed. A kind of host cell, mammalian cell or bacillus coli, which the recombination BMP-9 can be expressed. Recombination human BMP-9 arrangements for preparing drug that can stimulate sclerotomal cell differentiation and new bone formation, promote bone fracture assimilation and treat bone fracture and bone defection disease. The invention has advantage of mammalian cell and bacillus coli is initial success in utilizing expression human BMP-9 recombination protein and BMP-9 recombination protein have the function of stimulating bone formation, promoting renovation of bone defection and bone fraction.
Owner:JIAXING BOYI BIO TECH DEV

Expression of zebrafish bone morphogenetic protein 4

Embodiments of the invention generally provide isolated DNA molecules, tissue-specific expression sequences, and promoter and regulatory DNA sequences involved in the regulation of bone morphogenetic protein 4 (BMP4). More specifically, the invention relates to regulation of gene expression in a tissue-specific manner. In one aspect, the invention provides zebrafish BMP4 gene, its structural organization, its promoter, and proximal and distal regulatory regions. In another aspect, the invention provides methods for identifying potential compounds / agents, potential molecular regulators, and the expression pattern for the expression of BMP4 gene.
Owner:ACAD SINIC

SARA proteins

InactiveUS7105636B1Increasing and decreasing availabilityModulate its functionSugar derivativesPeptide/protein ingredientsSARA ProteinSMAD
Owner:HSC RES & DEV LLP

Bone morphogenetic protein-2/basic fibroblast growth factor (BMP-2/bFGF) double-gene chitosan nano-microcapsules and application thereof

The invention provides bone morphogenetic protein-2 / basic fibroblast growth factor (BMP-2 / bFGF) double-gene chitosan nano-microcapsules. The substrate of the nano-microcapsules is chitosan, the coated plasmids are green fluorescent protein marked BMP-2 and red fluorescent protein marked human bFGF, and the mass ratio of the plasmids to the chitosan is 1:1. Experiments prove that the BMP-2 and bFGF double genes coated by the chitosan nano-microcapsules can enter cells simultaneously and are effectively expressed, so the nano-microcapsules can be applied to the preparation of a medicine for thegene therapy of bone defect. The preparation method for the microcapsules is simple, conditions are mild, the effect is good, the chitosan can be completely degraded and metabolized in vivo, the decomposition product and metabolite of the chitosan are harmless to human health, and a good application prospect is achieved.
Owner:ZHEJIANG UNIV

Method for predicating milk yield of small tailed han sheep by virtue of BMPR (bone morphogenetic protein receptor )-1B or PRLR (prolactin receptor) gene SNP (single nucleotide polymorphism) lotus

The invention relates to the raise livestock field, and discloses a method for predicating milk yield of small tailed han sheep by virtue of BMPR(bone morphogenetic protein receptor )-1B or PRLR (prolactin receptor) gene SNP (single nucleotide polymorphism) lotus. The method comprises the following steps: extracting a small tailed han sheep genome DNA (deoxyribonucleic acid); amplifying a sequence of SNP lotus-containing BMPR-IB A746G or a sequence of SNP lotus-containing PRLR gene; judging an E2-C34T mutant gene type of the BMPR-IB A746G or PRLR gene. The method disclosed by the invention can be applied to carrying out feeding and management according to difference of milk secretion control gene types, and can be used for improving the milk secretion amount, guaranteeing that a lamb has enough milk intake, improving the survival rate and reducing the breeding economic loss. The method disclosed by the invention provides a molecular-level technical support for predicating and molecularly selecting the milk yield of small tailed han sheep; by applying the method disclosed by the invention, the survival rate and development rate of the lambs are greatly improved, so that better breeding economic benefits are produced, and therefore, the method has good application prospect.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Induction method for improving capacity of mesenchymal stem cells in promoting acute myeloid leukemia cell differentiation

The invention belongs to the technical field of medical biology, and particularly relates to an application of an induction method for improving the capacity of mesenchymal stem cells in promoting acute myeloid leukemia cell differentiation. The mesenchymal stem cells provided by the invention are human-derived umbilical cord mesenchymal stem cells (UC-MSCs), and mesenchymal stem cells (pre-activeMSCs) obtained after pretreatment and activation by cytokine bone morphogenetic protein 6 (BMP6); the pre-active MSCs can efficiently induce the acute myeloid leukemia cell differentiation, and the capacity is achieved by changing the expression quantity of IL-6 and IDO of the UC-MSCs; and the mesenchymal stem cells are allogeneic mesenchymal stem cells, the secretion capacity of the mesenchymalstem cells can be remarkably changed after the mesenchymal stem cells are treated and activated by the BMP6, and the AML resistance of the mesenchymal stem cells is remarkably enhanced. Compared withchemotherapy, mesenchymal stem cell transplantation has lower toxic and side effects, has low immunogenicity and meets clinical requirements. According to the method, the capacity of the MSCs in inducing the acute myelogenous leukemia cell differentiation is improved by adopting the method of pretreating and activating the MSCs through the BMP6, and the method can be applied to differentiation treatment of acute myelogenous leukemia.
Owner:NANJING UNIV