Detection method of nucleic acid

A nucleic acid and nuclease technology, which is used in biochemical equipment and methods, microbial determination/inspection, material excitation analysis, etc., to achieve the effect of improving sensitivity, simple and efficient methods

Inactive Publication Date: 2015-12-23
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI +1
View PDF6 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, the above-mentioned proteins are mainly used as gene editing tools, and there are no reports of using them to detect nucleic acids in samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of nucleic acid
  • Detection method of nucleic acid
  • Detection method of nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0155] Example 1 uses a split-type firefly luciferase (nucleotide sequence shown in SEQ.ID.NO: 14) as a signal-generating protein, and its N-terminal fragment (Nfluc) has a sequence from position 1 to position 1248. The amino acid sequence encoded by the nucleotide, the C-terminal fragment (Cfluc) has the amino acid sequence encoded by the 1194th-1650th nucleotide. Use dCas9 (nucleotide sequence as shown in SEQ.ID.NO: 15) as the nuclease-deficient Cas9. The first fusion protein is a dCas9 protein (Nfluc-dCas9) that has a connecting peptide and a histidine tag and is fused with a firefly luciferase N-terminal fragment at the N-terminus, and the second fusion protein is a protein that has a connecting peptide and a histidine tag. dCas9 protein tagged and N-terminally fused to the C-terminal fragment of firefly luciferase (Cfluc-dCas9). Wherein, the nucleotide sequence encoding the connecting peptide is GGTGGCGGTGGCtctGGTGGCGGTGGCTCT (SEQ.ID.NO: 16).

[0156] The target DNA use...

Embodiment 2

[0206] In this example, the same fusion protein as in Example 1 was used, and the Bacillus subtilis genome (NCBI access NO: NC_000964) was used as the target DNA.

[0207] Using the same method as in Example 1, three pairs of sgRNA were designed and synthesized for the specific sequence of the Bacillus subtilis genome, named sgRNAPair6, sgRNAPair7 and sgRNAPair8, respectively. The concentration of Bacillus subtilis genomic DNA in the sample was 318.4 ng / μL. The final concentration of Bacillus subtilis genomic DNA used in the detection was 0.012 nM. A sample added with Escherichia coli genome (NCBIaccessNO: NC_000913) was used as a negative control, and the final concentration of Escherichia coli genome DNA in the detection was 0.015nM.

[0208] sgRNA pair sequence

[0209] sgRNAPair6atcatcccctcatcaatgggggcatccaccatctttgtcc

[0210] sgRNAPair7tggtatgaatcccatggttatgctgagactgttatcatat

[0211] sgRNAPair8ggaggttttggtaagggtatgtgatggtcaaggcaacaat

[0212] The results are shown ...

Embodiment 3

[0214] In this example, PCR is used as pretreatment, the same fusion protein as in Example 1 is used, and the setting of detection objects is the same as in Example 2. In the amplification negative control, the same concentration of pSB1C3 plasmid was used as the amplification template.

[0215] In the pretreatment step, conventional PCR was performed using a primer pair capable of specifically amplifying the Bacillus subtilis yraO gene fragment (forward primer: aacgaacagctgaaatggaagtgc; reverse primer: gcgcattcttggaggtgtaatatg) and the amplified product (size 2k) to recycle. The concentration of Bacillus subtilis genomic DNA in the initial sample was 318.4 ng / μL (same as Example 2). Using the recovered product as a sample (where the final concentration of DNA is 3nM), follow the same steps as in Example 2, add fusion protein and sgRNA pair, and implement the detection method of the present invention.

[0216] Such as Figure 6 As shown, compared with Example 2, using PCR a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an in vitro detection method that whether a sample contains target nucleic acid or not is detected by utilizing fusion protein of split-signaling morphogenetic protein and nucleic acid enzyme defect type Cas9 protein, a kit and a device.

Description

technical field [0001] The invention belongs to the field of biological detection, and relates to an invitro method, kit and equipment for detecting whether a target nucleic acid exists in a sample by using a fusion protein of a split-type signal generating protein and a nuclease-deficient Cas9 protein. Background technique [0002] Nucleic acid detection methods have a wide range of applications in the fields of modern medicine, food safety and public health. Especially when detecting infectious pathogens in food, drinking water, and patient body fluid samples, in order to formulate targeted treatments or solutions faster, it is necessary to obtain the types, concentrations and Information on resistance, etc. However, due to the sensitivity limitations of traditional detection methods, samples that may contain the pathogenic bacteria to be detected need to be incubated for several hours to several days before conventional detection methods such as reverse transcription, PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/44C12Q1/66C12Q1/26C12Q1/25C12Q1/48G01N21/64
Inventor娄春波欧阳颀张益豪魏伟佳
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI