Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof
A morphogenetic protein and nucleotide sequence technology, applied in the fields of peptide/protein components, biochemical equipment and methods, recombinant DNA technology, etc. The effect of promoting fracture repair
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1. Nucleotide and amino acid sequences of human bone morphogenetic protein-9.
[0050] The nucleotide sequence of the cloned and expressed human bone morphogenetic protein-9 (BMP-9) cDNA and the amino acid sequence of the protein ( figure 1 ).
Embodiment 2
[0051] Example 2, using mammalian cells to express human BMP-9.
[0052] To express human BMP-9 protein in mammalian cells, the encoded full-length human BMP-9 cDNA was cloned into mammalian cell expression vector pcDNA3. The transfection method is the method using lipofectamine plus reagent. The transfected cells were Chinese hamster ovary (CHO) cells. Since the pcDNA3 plasmid contains a gene resistant to Neomycin, after the pcDNA3 / BMP-9 expression vector is stably transfected into CHO cells, neomycin is added to the culture medium, and the cell line expressing BMP-9 has anti-Neomycin properties of neomycin, other cells were killed by neomycin. The stably transfected cells were then cloned. The method of cloning cells is the method of limiting dilution (Limiting dilution). Neomycin-resistant cells were diluted to 1 cell / 200 microliter culture medium and added to 96-well culture dishes (200 microliters per well). After 2-3 weeks, this monoclonal cell line grows into a cel...
Embodiment 3
[0055] Example 3. Expression of human BMP-9 with Escherichia coli.
[0056] The cDNA of the mature fragment of human BMP-9 was amplified by PCR.
[0057] The storage number of the human BMP-9 gene bank is AF188285, the nucleotide sequence of the upstream primer is: caccatgagcgccggggctggcag and the nucleotide sequence of the downstream primer is: ctacctgcacccaacactctg. The PCR reagents included 1 μl of upstream primer (10 nM), 1 μl of downstream primer (10 nM), 1 μl of cDNA template and 17 μl of PlatenumPCR Supermix. The PCR conditions are: 95°C / 5 minutes; 95°C / 30 seconds, 56°C / 30 seconds, 72°C / 40 seconds, 35 cycles (cycles), 72°C / 2 minutes. The PCR product (300-bp) was separated by 2% agarose gel, purified by Qiagen DNA purification kit, and then redissolved by 20 microliters of TE buffer.
[0058] Cloning of BMP-9 PCR products into expression vectors
[0059] In order to introduce an appropriate restriction site consistent with the expression vector, we first cloned the PC...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com