Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof

A morphogenetic protein and nucleotide sequence technology, applied in the fields of peptide/protein components, biochemical equipment and methods, recombinant DNA technology, etc. The effect of promoting fracture repair

Inactive Publication Date: 2006-10-11
JIAXING BOYI BIO TECH DEV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A variety of growth factors that promote bone formation have been discovered, but the process and technology to obtain purified bone growth factors are still unclear and are in the initial stage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof
  • Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof
  • Nucleotide sequence for human morphogenetic protein 9 recombinant proteins and production method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Nucleotide and amino acid sequences of human bone morphogenetic protein-9.

[0050] The nucleotide sequence of the cloned and expressed human bone morphogenetic protein-9 (BMP-9) cDNA and the amino acid sequence of the protein ( figure 1 ).

Embodiment 2

[0051] Example 2, using mammalian cells to express human BMP-9.

[0052] To express human BMP-9 protein in mammalian cells, the encoded full-length human BMP-9 cDNA was cloned into mammalian cell expression vector pcDNA3. The transfection method is the method using lipofectamine plus reagent. The transfected cells were Chinese hamster ovary (CHO) cells. Since the pcDNA3 plasmid contains a gene resistant to Neomycin, after the pcDNA3 / BMP-9 expression vector is stably transfected into CHO cells, neomycin is added to the culture medium, and the cell line expressing BMP-9 has anti-Neomycin properties of neomycin, other cells were killed by neomycin. The stably transfected cells were then cloned. The method of cloning cells is the method of limiting dilution (Limiting dilution). Neomycin-resistant cells were diluted to 1 cell / 200 microliter culture medium and added to 96-well culture dishes (200 microliters per well). After 2-3 weeks, this monoclonal cell line grows into a cel...

Embodiment 3

[0055] Example 3. Expression of human BMP-9 with Escherichia coli.

[0056] The cDNA of the mature fragment of human BMP-9 was amplified by PCR.

[0057] The storage number of the human BMP-9 gene bank is AF188285, the nucleotide sequence of the upstream primer is: caccatgagcgccggggctggcag and the nucleotide sequence of the downstream primer is: ctacctgcacccaacactctg. The PCR reagents included 1 μl of upstream primer (10 nM), 1 μl of downstream primer (10 nM), 1 μl of cDNA template and 17 μl of PlatenumPCR Supermix. The PCR conditions are: 95°C / 5 minutes; 95°C / 30 seconds, 56°C / 30 seconds, 72°C / 40 seconds, 35 cycles (cycles), 72°C / 2 minutes. The PCR product (300-bp) was separated by 2% agarose gel, purified by Qiagen DNA purification kit, and then redissolved by 20 microliters of TE buffer.

[0058] Cloning of BMP-9 PCR products into expression vectors

[0059] In order to introduce an appropriate restriction site consistent with the expression vector, we first cloned the PC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses production method and usage of nucleotide sequence of human bone morphological recombination protein9. A kind section of separate DNA that coding the nucleotides sequence of human bone morphological protein9. A kind of protein: mammalian cell and bacillus coli expression human bone morphological recombination protein9. A kind of vector: the nucleotide sequences that encode BMP-9 were inserted plasmid victor, when the plasmid victor amplification in mammalian cell or bacillus coli, the recombination BMP-9 can be expressed. A kind of host cell, mammalian cell or bacillus coli, which the recombination BMP-9 can be expressed. Recombination human BMP-9 arrangements for preparing drug that can stimulate sclerotomal cell differentiation and new bone formation, promote bone fracture assimilation and treat bone fracture and bone defection disease. The invention has advantage of mammalian cell and bacillus coli is initial success in utilizing expression human BMP-9 recombination protein and BMP-9 recombination protein have the function of stimulating bone formation, promoting renovation of bone defection and bone fraction.

Description

technical field [0001] The invention relates to a human bone morphogenetic protein 9 recombinant protein nucleotide sequence, production method and application. Background technique [0002] Bone is a highly specialized tissue, and its components include collagen, proteoglycans, non-collagenous proteins, and esters. The renewal and repair of bone tissue throughout life is accomplished by specific cells. Bone growth is accomplished by osteoblasts, and bone remodeling is accomplished jointly by osteoclasts and osteoblasts. [0003] In pathological cases, fractures can be treated with the application of factors that promote bone growth. These factors can promote the healing of open fractures, improve the fixation of artificial joints, repair congenital and traumatic skull defects, and be used in cosmetic surgery. In addition, it can be used in the treatment of periodontal or other dental restorations. [0004] The current treatment for fractures, cranial and periodontal def...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70C12N15/85A61K38/17A61P19/00
Inventor 陈棣耿健晨李恒林鲍忆
Owner JIAXING BOYI BIO TECH DEV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap