Adenovirus with zinc finger nuclease expression element and donor DNA, and construction method and application
A technology for zinc finger nuclease and expression element, which is applied in the field of adenovirus carrying zinc finger nuclease expression element and donor DNA and its construction, and can solve the problems of low transfection efficiency and unusability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Taking an adenovirus carrying a zinc finger nuclease expression element targeting AAVS1 and donor DNA as an example, the structure of the adenovirus is as follows:
[0042] The adenovirus vector is a type 5 adenovirus vector, and the E1 and E3 regions are deleted. A zinc finger nuclease expression element regulated by a Tet-on inducible promoter was inserted into the deleted E3 region. Among them, the Tet-on inducible promoter consists of the following structure: 7 repeated tetracycline response elements (TRE), and the promoter core elements are connected to both ends of the 7 repeated TRE, including the miniCMV on the left and the tight miniCMV on the right ,
[0043] The sequence of miniCMV is as follows:
[0044] GGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTC
[0045] The sequence of tight miniCMV is as follows:
[0046] GGTCGACTAGGCGTGTACGGTGGGAGGCCTATATAAGCAG...
Embodiment 2
[0150] Taking the construction of an adenoviral vector carrying a zinc finger nuclease expression element targeting AAVS1 and a donor DNA (the donor DNA carries a reporter gene expression element) as an example, the structure of the vector is as follows:
[0151] A zinc finger nuclease expression element regulated by a Tet-on inducible promoter is inserted into the deleted E3 region of the adenovirus vector. The Tet-on inducible promoter is composed of the following structure: 7 repeated TREs (rtTA2S-M2 binding sites), and the core elements of the promoter are connected at both ends of the repeated sequences, including miniCMV on the left and tight on the right miniCMV, the rtTA2S-M2 transcription factor and SV40pA are linked downstream of the left miniCMV. The transcription termination signal SV40pA, or TKpA, is connected downstream of the tight miniCMV on the right side, and there is a multiple cloning site between the tight miniCMV and its downstream SV40pA, and the zinc fi...
Embodiment 3
[0168] Taking the construction of an adenoviral vector carrying a zinc finger nuclease expression element targeting AAVS1 and donor DNA (the donor DNA contains 50 bp upstream and downstream homology arms) as an example, the structure of the vector is as follows:
[0169] A zinc finger nuclease expression element regulated by a Tet-on inducible promoter is inserted into the E3 region of the adenovirus vector. The Tet-on inducible promoter is composed of the following structure: 7 repeated TREs (rtTA2S-M2 binding sites), and the core elements of the promoter are connected at both ends of the repeated sequences, including miniCMV on the left and tight on the right miniCMV, the rtTA2S-M2 transcription factor and SV40pA are linked downstream of the left miniCMV. The transcription termination signal SV40pA (or TKpA) is connected downstream of the tight miniCMV on the right side, and there is a multiple cloning site between the tight miniCMV and its downstream SV40pA, and a zinc fing...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 