Adenovirus with zinc finger nuclease expression element and donor DNA, and construction method and application

A technology for zinc finger nuclease and expression element, which is applied in the field of adenovirus carrying zinc finger nuclease expression element and donor DNA and its construction, and can solve the problems of low transfection efficiency and unusability.

Inactive Publication Date: 2014-12-10
SHAANXI NORMAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Nucleofection is usually used in in vitro experiments. This method has a high transfection efficiency, but this method is only limited to some cells, and the transfection efficiency for some cells is still very low, and this method cannot be tested in vivo used in

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenovirus with zinc finger nuclease expression element and donor DNA, and construction method and application
  • Adenovirus with zinc finger nuclease expression element and donor DNA, and construction method and application
  • Adenovirus with zinc finger nuclease expression element and donor DNA, and construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Taking an adenovirus carrying a zinc finger nuclease expression element targeting AAVS1 and donor DNA as an example, the structure of the adenovirus is as follows:

[0042] The adenovirus vector is a type 5 adenovirus vector, and the E1 and E3 regions are deleted. A zinc finger nuclease expression element regulated by a Tet-on inducible promoter was inserted into the deleted E3 region. Among them, the Tet-on inducible promoter consists of the following structure: 7 repeated tetracycline response elements (TRE), and the promoter core elements are connected to both ends of the 7 repeated TRE, including the miniCMV on the left and the tight miniCMV on the right ,

[0043] The sequence of miniCMV is as follows:

[0044] GGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTC

[0045] The sequence of tight miniCMV is as follows:

[0046] GGTCGACTAGGCGTGTACGGTGGGAGGCCTATATAAGCAG...

Embodiment 2

[0150] Taking the construction of an adenoviral vector carrying a zinc finger nuclease expression element targeting AAVS1 and a donor DNA (the donor DNA carries a reporter gene expression element) as an example, the structure of the vector is as follows:

[0151] A zinc finger nuclease expression element regulated by a Tet-on inducible promoter is inserted into the deleted E3 region of the adenovirus vector. The Tet-on inducible promoter is composed of the following structure: 7 repeated TREs (rtTA2S-M2 binding sites), and the core elements of the promoter are connected at both ends of the repeated sequences, including miniCMV on the left and tight on the right miniCMV, the rtTA2S-M2 transcription factor and SV40pA are linked downstream of the left miniCMV. The transcription termination signal SV40pA, or TKpA, is connected downstream of the tight miniCMV on the right side, and there is a multiple cloning site between the tight miniCMV and its downstream SV40pA, and the zinc fi...

Embodiment 3

[0168] Taking the construction of an adenoviral vector carrying a zinc finger nuclease expression element targeting AAVS1 and donor DNA (the donor DNA contains 50 bp upstream and downstream homology arms) as an example, the structure of the vector is as follows:

[0169] A zinc finger nuclease expression element regulated by a Tet-on inducible promoter is inserted into the E3 region of the adenovirus vector. The Tet-on inducible promoter is composed of the following structure: 7 repeated TREs (rtTA2S-M2 binding sites), and the core elements of the promoter are connected at both ends of the repeated sequences, including miniCMV on the left and tight on the right miniCMV, the rtTA2S-M2 transcription factor and SV40pA are linked downstream of the left miniCMV. The transcription termination signal SV40pA (or TKpA) is connected downstream of the tight miniCMV on the right side, and there is a multiple cloning site between the tight miniCMV and its downstream SV40pA, and a zinc fing...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an adenovirus with a zinc finger nuclease expression element and a donor DNA with a deleted E1 zone and a deleted E3 zone, and the deletion zones are inserted with the zinc finger nuclease expression element and the donor DNA. The construction method includes the following steps: constructing an adenovirus skeleton vector; constructing an adenovirus E3 zone shuttle vector with the zinc finger nuclease expression element; constructing an adenovirus E1 zone shuttle vector with the donor DNA, packing, amplifying and purifying. The invention discloses the purposes of the adenovirus with the zinc finger nuclease expression element and the donor DNA in preparation of medicament for treating genetic disease.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an adenovirus carrying a zinc finger nuclease expression element and a donor DNA, a construction method and application thereof. technical background [0002] The targeted modification of the genome includes the modification of the endogenous gene sequence of the genome or the insertion of exogenous gene fragments at specific positions in the genome. This technology provides a powerful tool for studying specific gene functions. In addition, researchers can use this technology to establish specific animal models for gene function research or new drug development. The traditional gene targeting modification technology relies on homologous recombination (Homologous recombination, HR) in the natural state, and the efficiency is very low, about 10 -6 , thus greatly limiting the application of this technology. The emergence of zinc finger nuclease (Zinc finger nuclease, ZFN) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N7/01C12N15/861A61K48/00A61P7/04A61P43/00
Inventor夏海滨张伟锋刘思也
OwnerSHAANXI NORMAL UNIV