Hyperlipemia susceptible noninvasive detection kit (APOB and other genes)

A hyperlipidemia and kit technology, applied in the field of molecular biology, can solve the problems of reducing the normal absorption of drugs, affecting the treatment effect of hyperlipidemia, and reducing the intake capacity

Inactive Publication Date: 2014-01-29
解码(上海)生物医药科技有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, more than 20 single nucleotide polymorphism (SNP) mutations have been found on the OATP1B1 gene, which will greatly reduce the ability of cells to uptake OATP1B1 substrates and be related to abnormal transport functions
Medical workers genotyped 24 healthy males from across the country and their absorption of pitavastatin, a commonly used drug for hyperlipidemia, found that the absorption of pitavastatin in the 52l T > C mutation group was significantly lower than that of the wild-type 521TT Homozygous, which indicates that mutations in this gene will reduce the normal absorption of the drug, thereby affecting the therapeutic effect of hyperlipidemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kits

[0022] 1. Extract DNA template

[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) APOB (EcoRI) forward primer: 5'TGGCTTGCTAACCTCTCTG3'

[0027] APOB (EcoRI) reverse primer: 5'CTTGAGAGACTGAATGGC3'

[0028] (2) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'

[0029] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'

[0030] (3) SLCO1B1 (T521C) forward primer: 5'TCTATCCTTACACTTCACC3'

[0031] SLCO1B1 (T521C) reverse primer: 5'ACGCACAACTTGGATTAGC3'

[0032] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ul; 25mM dNTP mixture 0.2ul, 5U / ul Taq enzyme 0.125ul, DNA template 1ul (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ul, d...

Embodiment 2

[0047] Example 2. Non-invasive detection of genes for the prevention of hyperlipidemia for the population

[0048] 1. Sampling and DNA extraction

[0049] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.

[0050] 2. Genotype detection

[0051] Using the kit provided by the present invention, the three single nucleotide polymorphism sites of EcoRI on the APOB gene, C677T (rs1801133) on the MTHFR gene, and T521C (rs4149032) on the SLCO1B1 gene of the subject's genomic DNA were subjected to DNA analysis respectively. Sequencing was performed to determine the genotypes of the three SNPs.

[0052] 3. Risk assessment and analysis of high-risk groups with hyperlipidemia

[0053] Through the analysis of the SNPs genotype of the subjects, a hyperlipidemia risk assessment analysis report is issued. The report detai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a noninvasive detection kit for detecting hyperlipemia susceptible genes. The kit comprises specific primers and DNA (deoxyribonucleic acid) sequencing primers for detecting 3 mononucleotide polymorphism site genotypes (EcoRI on APOB gene, C677T (rs1801133) on MTHFR gene, and T521C (rs4149032) on SLCO1B1 gene), a PCR (polymerase chain reaction) component, a PCR product purification component, a DNA sequencing reaction component and the like. The kit evaluates the hyperlipemia attack risk level by detecting the 3 mononucleotide polymorphism site genotypes closely related to hyperlipemia on the gene level, and instructs people to prevent the occurrence of diseases in advance. The sampling method is an oral mucosa cell sampling method which is painless and noninvasive and avoids cross infection. The kit has the advantage of accurate and reliable sequencing detection result, and does not need to buy expensive imported special instruments; and thus, the method is easy to popularize.

Description

technical field [0001] This project belongs to the field of molecular biology and involves medicine and biotechnology. It specifically involves a non-invasive detection kit for hyperlipidemia susceptibility genes. Recommendations guide for hyperlipidemia. Background technique [0002] With the improvement of people's living standards, the number of patients with cardiovascular and cerebrovascular diseases is increasing year by year. Cardiovascular and cerebrovascular diseases have become another major killer of human death after cancer! A large number of studies have shown that: hyperlipidemia (hyperlipidemia, HLP), etc. Lipid metabolism disorder is an important cause of cardiovascular and cerebrovascular diseases that cannot be ignored. Hyperlipidemia is an important risk factor for coronary atherosclerotic heart disease (coronary heart disease), cerebral infarction, sudden cardiac death and other diseases, and is also an important risk factor for hypertension, impaired gl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 郑俊斌
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products