Hyperlipemia susceptible noninvasive detection kit (APOB and other genes)
A hyperlipidemia and kit technology, applied in the field of molecular biology, can solve the problems of reducing the normal absorption of drugs, affecting the treatment effect of hyperlipidemia, and reducing the intake capacity
Examples
Embodiment 1
[0021] Example 1. Use of detection kits
[0022] 1. Extract DNA template
[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) APOB (EcoRI) forward primer: 5'TGGCTTGCTAACCTCTCTG3'
[0027] APOB (EcoRI) reverse primer: 5'CTTGAGAGACTGAATGGC3'
[0028] (2) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'
[0029] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'
[0030] (3) SLCO1B1 (T521C) forward primer: 5'TCTATCCTTACACTTCACC3'
[0031] SLCO1B1 (T521C) reverse primer: 5'ACGCACAACTTGGATTAGC3'
[0032] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ul; 25mM dNTP mixture 0.2ul, 5U / ul Taq enzyme 0.125ul, DNA template 1ul (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ul, d...
Embodiment 2
[0047] Example 2. Non-invasive detection of genes for the prevention of hyperlipidemia for the population
[0048] 1. Sampling and DNA extraction
[0049] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0050] 2. Genotype detection
[0051] Using the kit provided by the present invention, the three single nucleotide polymorphism sites of EcoRI on the APOB gene, C677T (rs1801133) on the MTHFR gene, and T521C (rs4149032) on the SLCO1B1 gene of the subject's genomic DNA were subjected to DNA analysis respectively. Sequencing was performed to determine the genotypes of the three SNPs.
[0052] 3. Risk assessment and analysis of high-risk groups with hyperlipidemia
[0053] Through the analysis of the SNPs genotype of the subjects, a hyperlipidemia risk assessment analysis report is issued. The report detai...
PUM
Login to View More Abstract
Description
Claims
Application Information
- IPC
- C12Q1/68
- CPC
- C12Q1/6883; C12Q2600/156
- Inventors
- 郑俊斌