Unlock instant, AI-driven research and patent intelligence for your innovation.

Small heat shock protein hsp gene, expression vector and its construction and application derived from Pyromyces furiosus

A technology of intense flame fungus and heat shock protein, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of inhibition, the total solvent content of fermentation cannot be improved, and the production of butanol is insufficient.

Inactive Publication Date: 2016-03-30
SHANGHAI ACAD OF AGRI SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Due to the polar nature of the butanol molecule, its interaction with the cell membrane of Clostridium inhibits the transmembrane transport system and its enzyme activity of Clostridium, eventually leading to cell lysis. It is precisely because of the toxicity of butanol that it severely inhibits the fermentation process went smoothly
Therefore, the total solvent content of fermentation cannot be improved, and the butanol production is insufficient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small heat shock protein hsp gene, expression vector and its construction and application derived from Pyromyces furiosus
  • Small heat shock protein hsp gene, expression vector and its construction and application derived from Pyromyces furiosus
  • Small heat shock protein hsp gene, expression vector and its construction and application derived from Pyromyces furiosus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Synthesis of the small heat shock protein HSP gene from Pyrococcus furiosus

[0025] Under the premise of not changing the amino acid sequence, the HSP gene (GenbankAF256212) from Pyrococcus furiosus was synthesized according to the preferred codons of Clostridium, and the primers were designed and artificially synthesized. The primers are as follows, and the primer length is 50-60bp.

[0026] Pfhsp1:GGATCCATGGTTAGAAGAATTAGAAGATGGGATATTGGGACCCATTTGATCTTATTAGA

[0027] Pfhsp2:AAAATTCATCAAACATTGCATCAATTTCCTCTTGAATTTCTCTAATAAGATCAAATGGGT

[0028] Pfhsp3: TGCAATGTTTGATGAATTTTTTAGTAGACCCAAGACTTTGGACTTATAGAAGATGGAGTGA

[0029] Pfhsp4:TCTCCAAACTTCTCCAACTTCTCTCTTCATACATTGCTGGTTCACTCCATTCTTCTATAAGT

[0030] Pfhsp5:GAGTTGGAGAAGTTTGGAGAGAACCATTTGTTGATATTTTGATAATGGAGATGAGTTTG

[0031] Pfhsp6:ATATCTTCTTTTCTAACTCCTGGAAGTTCTGCTGTAATAACAAACTCATCTCTCCATTATCA

[0032] Pfhsp7: GGAGTTAGAAAAGAAGATATTAAAGTTAGGTTACTGAGGATACTGTTTATATTGAGGCA

[0033] Pfhsp8: CTGCCTCCTTCTCTTTCAAG...

Embodiment 2

[0041] Example 2 Construction of the Escherichia coli-clostridium shuttle expression vector containing the PfHSPS gene

[0042] Based on the pSOS94 vector (Desai1999, ApplEnvironMicrobiol), the chloramphenicol resistance gene expression unit, the Clostridium CAC2546 gene (NC_003030) promoter, the open reading frame of the PfHSPS gene obtained in Example 1 and the Bacillus subtilis pyruvatekinase (PYK, NC_000964) gene terminator (PYK) was ligated to replace the ctfAB and abc expression units in the pSOS94 vector to construct a Clostridium-Escherichia coli shuttle expression vector pPFHSP containing the PfHSPS gene expression unit controlled by a strong promoter (see figure 1 ), the vector is about 6720bp. The specific construction steps are as follows:

[0043] The chloramphenicol expression unit was amplified from pXYP251 (GenBank accession number AY178046, containing a medium-strength prokaryotic PGm promoter and terminator T1T2) vector. The primers are cm1:5'-AAGCTTATAACTT...

Embodiment 3

[0048] Embodiment 3 transformation plasmid treatment and transformation method

[0049] The Escherichia coli-Clostridium shuttle expression vector pPFHSP constructed in Example 2 above contains ampicillin and erythromycin resistance, can replicate in Escherichia coli, and can screen transformed Clostridium by erythromycin. The shuttle expression vector was methylated using the methylase on the pAN1 plasmid (Mermelstein1993, ApplEnvironMicrobiol), which contains the δ3T methyltransferase gene from Bacillus subtilis, which can achieve methylation protection of the Clostridium vector, thereby avoiding the plasmid It is cut by Cac824I restriction endonuclease in Clostridium because this restriction site widely exists in Clostridium.

[0050] Escherichia coli for plasmid amplification must use methylase-deficient strains, because when some cytosine methylated DNA is transformed into common E.coli strains, the transformation efficiency will be significantly reduced. The reason may ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to small heat shock protein HSP gene from strong flame bacteria, an expression carrier, as well as a construction method and application thereof. The base sequence of the gene is as shown in SEQ ID No1, the expression carrier is shuttled by constructing escherichia coli-clostridium containing the gene; shown by test, the HSP gene can be stably and efficiently expressed in the clostridium, so that the tolerance of the clostridium to butanol is effectively improved. Furthermore, by utilization of anaerobic fermentation, the condition that the butanol productivity of the clostridium can be greatly improved by the HSP gene is also shown.

Description

technical field [0001] The invention relates to a small heat shock protein HSP gene derived from Pyrococcus furiosus, an Escherichia coli-clostridium shuttle expression vector containing the gene and a construction method thereof, and their role in improving the butanol tolerance of Clostridium and Clostridium butanol production. Background technique [0002] The oil crisis in the 1970s prompted people to re-recognize the importance of the acetone-butanol fermentation industry, and the development and utilization of renewable energy has thus become an important measure for many countries to improve energy security, reduce greenhouse gas emissions, and address climate change. The most common biofuels currently on the market are fuel ethanol and biodiesel. As an important chemical raw material, bio-butanol is a potential second-generation biofuel (Durre2007, BiotechnolJ). Butanol has the following advantages over ethanol as a biofuel: 1) High energy content, comparable to eth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/74C12N1/21C12R1/145
Inventor 彭日荷姚泉洪田永生赵伟付晓燕朱波许晶高建杰韩红娟王波王丽娟韩静薛永
Owner SHANGHAI ACAD OF AGRI SCI