Small heat shock protein hsp gene, expression vector and its construction and application derived from Pyromyces furiosus
A technology of intense flame fungus and heat shock protein, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of inhibition, the total solvent content of fermentation cannot be improved, and the production of butanol is insufficient.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Synthesis of the small heat shock protein HSP gene from Pyrococcus furiosus
[0025] Under the premise of not changing the amino acid sequence, the HSP gene (GenbankAF256212) from Pyrococcus furiosus was synthesized according to the preferred codons of Clostridium, and the primers were designed and artificially synthesized. The primers are as follows, and the primer length is 50-60bp.
[0026] Pfhsp1:GGATCCATGGTTAGAAGAATTAGAAGATGGGATATTGGGACCCATTTGATCTTATTAGA
[0027] Pfhsp2:AAAATTCATCAAACATTGCATCAATTTCCTCTTGAATTTCTCTAATAAGATCAAATGGGT
[0028] Pfhsp3: TGCAATGTTTGATGAATTTTTTAGTAGACCCAAGACTTTGGACTTATAGAAGATGGAGTGA
[0029] Pfhsp4:TCTCCAAACTTCTCCAACTTCTCTCTTCATACATTGCTGGTTCACTCCATTCTTCTATAAGT
[0030] Pfhsp5:GAGTTGGAGAAGTTTGGAGAGAACCATTTGTTGATATTTTGATAATGGAGATGAGTTTG
[0031] Pfhsp6:ATATCTTCTTTTCTAACTCCTGGAAGTTCTGCTGTAATAACAAACTCATCTCTCCATTATCA
[0032] Pfhsp7: GGAGTTAGAAAAGAAGATATTAAAGTTAGGTTACTGAGGATACTGTTTATATTGAGGCA
[0033] Pfhsp8: CTGCCTCCTTCTCTTTCAAG...
Embodiment 2
[0041] Example 2 Construction of the Escherichia coli-clostridium shuttle expression vector containing the PfHSPS gene
[0042] Based on the pSOS94 vector (Desai1999, ApplEnvironMicrobiol), the chloramphenicol resistance gene expression unit, the Clostridium CAC2546 gene (NC_003030) promoter, the open reading frame of the PfHSPS gene obtained in Example 1 and the Bacillus subtilis pyruvatekinase (PYK, NC_000964) gene terminator (PYK) was ligated to replace the ctfAB and abc expression units in the pSOS94 vector to construct a Clostridium-Escherichia coli shuttle expression vector pPFHSP containing the PfHSPS gene expression unit controlled by a strong promoter (see figure 1 ), the vector is about 6720bp. The specific construction steps are as follows:
[0043] The chloramphenicol expression unit was amplified from pXYP251 (GenBank accession number AY178046, containing a medium-strength prokaryotic PGm promoter and terminator T1T2) vector. The primers are cm1:5'-AAGCTTATAACTT...
Embodiment 3
[0048] Embodiment 3 transformation plasmid treatment and transformation method
[0049] The Escherichia coli-Clostridium shuttle expression vector pPFHSP constructed in Example 2 above contains ampicillin and erythromycin resistance, can replicate in Escherichia coli, and can screen transformed Clostridium by erythromycin. The shuttle expression vector was methylated using the methylase on the pAN1 plasmid (Mermelstein1993, ApplEnvironMicrobiol), which contains the δ3T methyltransferase gene from Bacillus subtilis, which can achieve methylation protection of the Clostridium vector, thereby avoiding the plasmid It is cut by Cac824I restriction endonuclease in Clostridium because this restriction site widely exists in Clostridium.
[0050] Escherichia coli for plasmid amplification must use methylase-deficient strains, because when some cytosine methylated DNA is transformed into common E.coli strains, the transformation efficiency will be significantly reduced. The reason may ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 