Novel dosage form

A pharmaceutical dosage form, tablet technology, applied in the field of new dosage forms, can solve the problems of high item cost, increased chance of food effect, high variability among patients, etc.

Inactive Publication Date: 2014-08-13
NEUROVIVE PHARMA AB
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This can lead to higher item costs, increased chance of food effects, and higher inter-patient variability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel dosage form
  • Novel dosage form
  • Novel dosage form

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0486] Example 1 - Construction of the sfaA deletion mutant of Streptomyces sp. A92-308110 (DSM9954)

[0487] 1.1 Construction of sfaA deletion construct

[0488] The ~7 kb EcoRV-StuI fragment of cosmid TL3006 (SEQ ID NO. 3) including sfaA (nucleotide position 14396-21362, NCBI sequence accession number FJ809786) was excised by digestion with EcoRV and StuI, and the resulting The fragment was ligated directly into pKC1139 which had been previously digested with EcoRV and treated with shrimp alkaline phosphatase (Roche). This plasmid was designated pSGK268.

[0489] The in-frame deletion of the sfaA gene contained in this clone was performed using the Red / ET Recombination Kit provided by Gene Bridges (Cat. No. K006).

[0490] (SEQ ID NO.1)SfaA17161f5'-

[0491] CGCTCTGTGGCGCCTGGTTTCCAAGCGGCTCGCGGACCGGCACCGGCACATGCATAATTAACCCTCACTAAAGGGCG-3’

[0492] (SEQ ID NO.2) SfaA17825r5'-

[0493] TGGATGTATCGTCGCAGGACGCCCAGAATTCACCTGCGACGTCCTCCAGATGCATTAATACGACTCACTATAGGGCTC-3’

[04...

proportion 1

[0499]Mix the prepared E.coli ET12567pUZ8002pSGK271 and Biot-4370 in a ratio of 1:1 (250 μL of each strain) and 1:3 (100 μL of E.coli) and immediately spread it on the R6 plate and transfer to a 37°C incubator . After approximately 2 hours of incubation, the plates were overlaid with 2 ml sterile water containing nalidixic acid, resulting in a final in-plate concentration of 25 μg / L. Plates were returned to the 37°C incubator overnight before overlaying with 2ml of sterile water containing apramycin, resulting in a final in-plate concentration of 20-25 μg / L. The post-conjugant (Ex-conjugant) clones that appeared after ~4-7 days were patched into ISP4 medium containing apramycin (25 μg / L) and nalidixic acid (25 μg / L), and incubated at 37° C. incubate. Once proper hyphal growth was observed, the strains were re-patched to ISP4 medium containing apramycin (25 μg / L) at 37°C and allowed to sporulate. Strains were then subcultured three times by patching onto ISP4 (without antibi...

example 2

[0505] Example 2 - Additional methods for constructing sfaA deletion constructs

[0506] Other methods can be used to generate sfaA deletion mutants. Examples include sfaA insertional inactivation mutants (eg Example 12 from WO2010 / 034243). This strain was generated as described in WO2010 / 034243 and was given the name BIOT-4452.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

There is provided inter alia a pharmaceutical dosage form for oral administration comprising a sanglifehrin as active ingredient in which the sanglifehrin active ingredient is protected from acid degradation in the stomach environment following oral administration.

Description

technical field [0001] The present invention relates to the reduction of acid degradation in the stomach by protecting the drug substance, e.g. by enteric coating, for increasing sanglifehrins (including natural ) and non-natural sanglifehrins such as sangamides) for oral bioavailability. Oral bioavailability is expected to be increased by releasing the substance directly into the intestinal compartment of the subject, where sanglifehrin is less prone to degradation. Background technique [0002] Sanglifellin [0003] Sangliferin A (SfA), 5 and its natural congeners belong to the species produced by Streptomyces sp. A92-308110 (also known as DSM9954) (references WO97 / 02285 and WO98 / 07743), mixed The class of non-ribosomal peptides / polyketides, these substances were originally discovered on the basis of their high affinity for cyclophilin A (CypA). SfA is the most abundant component in the fermentation broth and exhibits an approximately 20-fold higher affinity for CyPA co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K9/00
CPCA61K9/4891A61K9/0053A61K38/12A61K9/0019A61K9/08A61K9/2866A61K31/5025A61K47/02A61K47/10A61K47/44
Inventor马修·艾伦·格雷戈里史蒂夫·詹姆斯·莫斯
OwnerNEUROVIVE PHARMA AB