Application of hypodermin A in preparation of preparation for inhibiting immunological rejection in organ transplantation

A technology of immune rejection and dermatocin, applied in medical preparations containing active ingredients, gene therapy, peptide/protein components, etc., can solve the problem of low long-term survival rate, achieve the goal of improving survival rate and inhibiting immune rejection Effect

Inactive Publication Date: 2015-04-01
XUZHOU MEDICAL COLLEGE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the problem of low long-term survival rate of transplanted organs due to immune rejection, we prepared HA transgenic mice to study the effect of HA on reducing immune rejection in mouse skin allografts, and then provided dermatocin A new use of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hypodermin A in preparation of preparation for inhibiting immunological rejection in organ transplantation
  • Application of hypodermin A in preparation of preparation for inhibiting immunological rejection in organ transplantation
  • Application of hypodermin A in preparation of preparation for inhibiting immunological rejection in organ transplantation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Example 1: Amplification of HA gene (accession number X74303)

[0012] Total RNA was extracted from the first-stage larvae of Psofida, and cDNA was synthesized by reverse transcription. Using cDNA as a template, the upstream and downstream primers are F1 5'-ATGCTGAAGTTTGTTATTTTATTGTGC-3' (SEQ ID NO. 1), R1 5'-TA GGATCC TTAAATAGATTC TGCATTACTGAC-3ˊ (SEQ ID NO. 2) (the underlined part is the restriction site of BamH I), the amplified fragment size is 771 bp. In order to obtain the secreted protein of the HA gene, a signal peptide sequence ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCC (SEQ ID NO.3) was added to the starting site of the HA gene by overlapping PCR method. At the same time, a pair of primers with enzyme cutting sites were designed: F2: 5ˊ-GT GAATTC ATGGAGACAGACACACTCC-3ˊ (SEQ ID NO.4) (the underlined part is the restriction site of EcoR I), R1: 5ˊ-TA GGATCC TTAAAT AGAT TCT GCATTACTGAC-3' (SEQ ID NO.5) (the underlined part is t...

Embodiment 2

[0013] Example 2: Construction of eukaryotic expression vector pEF1α-HA-AcGFP

[0014] The PCR product of the HA gene and the eukaryotic expression vector pEF1α-IRES-AcGFP (purchased by Treasure Bioengineering (Dalian) Co., Ltd.) were purified and recovered, and simultaneously digested with EcoR I and BamH I, and the digested product was digested with 1% agarose Gel electrophoresis, gel cutting and recovery were mixed at a molar ratio of 3:1, and ligated with T4 DNase for 3 h. The reaction product was transformed into DH5α competent cells, screened with a kanamycin plate, picked 8 single colonies, inoculated in 3 mL LB medium containing kanamycin, and cultured overnight at 37 °C with shaking. F3: AGCGGGCGGGTGAGTCA (SEQ ID NO.6) and R3: GATACTTGCCAAGGAAAATC (SEQ ID NO.7) were designed on the HA gene fragment and plasmid respectively

[0015] Primers, perform PCR on the cultured bacterial solution overnight, take the bacterial solution that shows the correct size of the amplifi...

Embodiment 3

[0016] Embodiment 3: Establishment of HA transgenic animal model

[0017] HA transgenic mice were prepared by microinjection technology (assisted by Guangzhou Saiye Biotech Co., Ltd.). figure 2 It was shown that HA transgenic mice successfully expressed HA protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of hypodermin A in preparation of a preparation for inhibiting immunological rejection in organ transplantation. According to the invention, an HA transgenetic mouse is prepared and the survival rate of the skin of the HA transgenetic mouse is remarkably higher than that of the skin of a mild mouse by virtue of allogeneic transplantation of the skin of the mouse. The preparation disclosed by the invention can be used for inhibiting immunological rejection in organ transplantation and improving the survival rate of organ transplantation, thereby providing an effective method for treating chronic end-stage diseases of organs such as liver, kidney, heart and the like.

Description

technical field [0001] The invention belongs to the field of organ transplant medicines, in particular to a new application of dermatoxin A (HyderminA, HA), which can reduce organ transplant rejection and provide a new method for allogeneic organ transplantation. Background technique [0002] Organ transplantation is the main method for treating chronic end-stage diseases such as liver, kidney and heart, and suppression of rejection is one of the key factors restricting the long-term survival of transplanted organs. Parasites can invade hosts with normal immune function, and can evade the host's immune effects, develop, reproduce, and survive. This phenomenon is called immune evasion. Psoriasis larvae can migrate in the host tissue for 8 months, and the four serine proteases dermatoxin A, B, C, and D secreted by it have an immunosuppressive effect on the host, so that the host cannot use the immune function to kill the fly larvae. The immunoregulatory function of HA suppr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17A61K48/00A61P37/06
Inventor陈仁金朱孝荣袁红花胡安康
OwnerXUZHOU MEDICAL COLLEGE