Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer capable of detecting CYP2C9*2 gene mutation, and detection method

A gene and primer pair technology, applied in the field of CYP2C9*2 gene mutation detection, can solve the problems of inhomogeneity, high misreading rate and lack of DNA, and achieve high accuracy.

Inactive Publication Date: 2015-06-03
WUHAN ADICON CLINICAL LAB
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] 1. The designed restriction enzyme digestion is affected by the purity of the enzyme itself, the quality of the DNA (mainly the purity), the pH value and ionic strength of the buffer of the enzyme digestion system, the temperature and time of enzyme digestion, etc. Usually, problems that may occur: DNA is not or not completely cut by endonuclease; the number of cut fragments is more than the theoretical value; the existence of DNA fragments is not observed after enzyme digestion, and the band pattern of DNA fragments is diffuse and uneven after electrophoresis.
[0012] 2. DNA gel electrophoresis after digestion of PCR amplified fragments is affected by the quality of agarose, gel preparation, pH value and ionic strength of the electrophoresis buffer, the amount of DNA sample added and the salt concentration in the DNA sample, which can change the mobility of DNA electrophoresis Usually, problems that may arise due to the influence of other factors: blurred DNA bands; migration of irregular DNA bands; weak or no DNA electrophoresis bands and missing DNA, etc.
[0013] Although the next-generation sequencing method has the characteristics of simplicity, speed, and high throughput, its fatal weakness is the high misreading rate, which does not meet the key point of clinical diagnosis --- high accuracy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer capable of detecting CYP2C9*2 gene mutation, and detection method
  • Primer capable of detecting CYP2C9*2 gene mutation, and detection method
  • Primer capable of detecting CYP2C9*2 gene mutation, and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The present invention will be further described below in conjunction with specific embodiments, and the advantages and characteristics of the present invention will become clearer along with the description. However, it should be understood that the described embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0033] 1. Sample requirements EDTA or ACD anticoagulated whole blood, the optimal amount is 5.0ml, the minimum amount is 2ml

[0034] Sterile and RNase-free vacuum blood collection tubes or test tubes refrigerated at 0-10°C for less than 2 days Severely hemolyzed samples and whole blood antic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer capable of detecting CYP2C9*2 gene mutation, and a detection method. The invention provides a primer pair for CYP2C9*2 gene mutation, and the nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a method for detecting whether the CYP2C9*2 gene is mutated by applying the primer pair, and the method comprises the following steps: (1) extracting a to-be-detected blood sample DNA; (2) performing PCR amplification; (3) determining the PCR amplified segment sequence by adopting a Sanger method; and (4) comparing a CYP2C9*2 gene standard sequence and a sample sequence, judging detection locus base defined in the standard sequence and the corresponding locus base in the sequencing sequence, and analyzing the type of the gene mutation locus. The amplified segment is sequenced by adopting a Sanger method, and by comparing the sequencing result and the standard sequence, the mutation of the detected base can be intuitively read out, and the accuracy is high.

Description

technical field [0001] The invention relates to primers and a detection method for detecting gene mutations, in particular to primers for detecting CYP2C9*2 gene mutations and a method for detecting CYP2C9*2 gene mutations using the primers, belonging to the field of detection of CYP2C9*2 gene mutations. Background technique [0002] The reference sequence number of the single nucleotide polymorphism of the CYP2C9*2 gene locus is rs1799853, and the 26th base C in this sequence (GATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCT; SEQ ID No.2) is the base to be detected, and the base at this position Usually, the mutation may directly affect the function of the cytochrome P450 superfamily enzyme encoded by the CYP2C9 gene (sequence number NG_008385.1). Cytochrome P450 proteins are monooxygenases, which are involved in the enzymatic reactions of drug metabolism, cholesterol, steroid and other lipid synthesis. This enzyme is involved in the metabolism of the anticoagulant warf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6827C12Q2600/156
Inventor 宋宇
Owner WUHAN ADICON CLINICAL LAB
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More