Primer capable of detecting CYP2C9*2 gene mutation, and detection method

Abstract

The invention discloses a primer capable of detecting CYP2C9*2 gene mutation, and a detection method. The invention provides a primer pair for CYP2C9*2 gene mutation, and the nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a method for detecting whether the CYP2C9*2 gene is mutated by applying the primer pair, and the method comprises the following steps: (1) extracting a to-be-detected blood sample DNA; (2) performing PCR amplification; (3) determining the PCR amplified segment sequence by adopting a Sanger method; and (4) comparing a CYP2C9*2 gene standard sequence and a sample sequence, judging detection locus base defined in the standard sequence and the corresponding locus base in the sequencing sequence, and analyzing the type of the gene mutation locus. The amplified segment is sequenced by adopting a Sanger method, and by comparing the sequencing result and the standard sequence, the mutation of the detected base can be intuitively read out, and the accuracy is high.

Description

technical field [0001] The invention relates to primers and a detection method for detecting gene mutations, in particular to primers for detecting CYP2C9*2 gene mutations and a method for detecting CYP2C9*2 gene mutations using the primers, belonging to the field of detection of CYP2C9*2 gene mutations. Background technique [0002] The reference sequence number of the single nucleotide polymorphism of the CYP2C9*2 gene locus is rs1799853, and the 26th base C in this sequence (GATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCT; SEQ ID No.2) is the base to be detected, and the base at this position Usually, the mutation may directly affect the function of the cytochrome P450 superfamily enzyme encoded by the CYP2C9 gene (sequence number NG_008385.1). Cytochrome P450 proteins are monooxygenases, which are involved in the enzymatic reactions of drug metabolism, cholesterol, steroid and other lipid synthesis. This enzyme is involved in the metabolism of the anticoagulant warf...

AI Technical Summary

Problems solved by technology

[0011] 1. The designed restriction enzyme digestion is affected by the purity of the enzyme itself, the quality of the DNA (mainly the purity), the pH value and ionic strength of the buffer of the enzyme digestion system, the temperature and time of enzyme digestion, etc. Usually, problems that may occur: DNA is not or not completely cut by endonuclease; the number of cut fragments is more than the theoretical value; the existence of DNA fragments is not observed after enzyme digestion, and the band pattern of DNA fragments is diffuse and uneven after electrophoresis.

[0012] 2. DNA gel electrophoresis after digestion of PCR amplified fragments is affected by the quality of agarose, gel preparation, pH value and ionic strength of the electrophoresis buffer, the amount of DNA sample added and the salt concentration in the DNA sample, which can change the mobility of DNA electrophoresis Usually, problems that may arise due to the influence of other factors: blurred DNA bands; migration of irregular DNA bands; weak or no DNA electrophoresis bands and missing DNA, etc.

[0013] Although the next-generation sequencing method has the characteristics of simplicity, speed, and high throughput, its fatal weakness is the high misreading rate, which does not meet the key point of clinical diagnosis --- high accuracy.

Images