Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene

A specific and genetic technology, applied in the fields of gene knockout and genetic engineering, can solve the problems of low recombination efficiency, tedious and time-consuming work, high off-target rate, etc., and achieve the effect of high cost and long solution cycle

Active Publication Date: 2016-04-20
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF2 Cites 43 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HR technology is inefficient due to reorganization (efficiency is only about 10 -6 ), the screening of mutants is very time-consuming and inefficient, and has gradually been replaced by
The cutting efficiency of TALEN technology and ZFN technology can generally reach 20%, but both require the construction of protein modules that can recognize specific sequences, and the preliminary work is tedious and time-consuming
The module design of ZFN technology is relatively complex and has a high miss rate, and its application is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene
  • Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene
  • Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1, Selection and design of Susscrofa (pig) CMAH gene sgRNA target sequence

[0068] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0069] 1. Selection of sgRNA target sequence for CMAH gene

[0070] For the CMAH gene, the following principles should be followed in the selection of target sequences:

[0071] (1) Find the target sequence in the exon coding region of the CMAH gene that conforms to the 5'-N(20)NGG-3' rule, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;

[0072] (2) Select the 5 exon coding region sequences near the N-terminus, the target sequence can be located in the 5 exon coding region...

Embodiment 2

[0088] Embodiment 2, constructing the sgRNA expression vector of CMAH gene

[0089] 1. Synthesis of DNA Inserts

[0090] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0091] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 2 and No. 4 sequences listed in Table 1 on the knockout effect of the CMAH gene was studied.

[0092] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 2 target sequence are as follows:

[0093] CACCGTTGAGATTGGCAGCTTCGGC (SEQ ID NO: 63);

[0094] AAACGCCGAAGCTGCCAATCTCAAC (SEQ ID NO: 64).

[0095] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 4 target sequence are as follows:

[0096] CACCGTGCCGAAGCTGCCAATCTCA (SEQ ID NO: 65);

[0097] AA...

Embodiment 3

[0133] Example 3. Obtaining a pseudotyped lentivirus expressing CMAHsgRNA

[0134] 1. Material preparation

[0135] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-CMAH; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0136] 2. Transfection and Viral Packaging

[0137] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;

[0138] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0139] Prepare Mixture 1, containing:

[0140] lentiCRISPRv2-CMAH: 6 μg

[0141] pL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting a CMAH gene. A target sequence of the sgRNA for specially targeting the CMAH gene on the CMAH gene meets a 5'-N(20)NGG-3' sequence arrangement rule, wherein the N(20) represents 20 continuous bases, and each N represents A, T, C or G; the target sequence on the CMAH gene locates at a 5-exon coding area or a junction position of adjacent introns of an N end of the CMAH gene; and the target sequence on the CMAH gene is unique. The sgRNA is used in a method for pig CMAH gene specific knockout through the CRISPR-Cas9, the pig CMAH gene can be rapidly, accurately, efficiently and specifically knocked out, and the problems of the long period and high cost of construction of a CMAH gene knockout pig are effectively solved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a CRISPR-Cas9 method for specifically knocking out the pig CMAH gene and an sgRNA for specifically targeting the CMAH gene. Background technique [0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relying on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/867
Inventor蔡志明牟丽莎谢崇伟高汉超刘璐陈鹏飞张军方陆赢
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN