Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit and method for assessing response of human body to daily diet

A kit and diet technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as aggravating health risks, and achieve the effect of achieving high efficiency and assisting diet management

Inactive Publication Date: 2016-05-18
WUHAN BAIYUAN TECH CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this case, if we still use the traditional diet concept, it will undoubtedly increase the health risks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit and method for assessing response of human body to daily diet
  • Detection kit and method for assessing response of human body to daily diet

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0061] Daily diet reaction gene detection kit, including the box body and reagents stored separately in the box body, the stored reagents include:

[0062] (1) PCR reaction primer set for 10 gene SNP polymorphic sites (the following primer sequence directions are all from 5' end to 3' end):

[0063] Primer set for SNPRS671:

[0064] 1CTGCAGGCATACACTA

[0065] 2CACAGTTTTTCACTTC

[0066] 3CCAAGAGTGATTTCTGC

[0067] 4GCAGGTCCTGAACTTCCAG

[0068] Primer set for SNPRS2187668:

[0069] 1GGCAGCTGAGAGTAAA

[0070] 2CCACATGGTCCTCAC

[0071] 3GTGAAGCTATATCTGTAATAG

[0072] 4GAAGTGTCATTCTC

[0073] Primer set for SNPRS762551:

[0074] 1GTGAGCTCTGTGGGCA

[0075] 2CATCTACCATGCGTCCTGG

[0076] 3GCATGCATGCTGTGCCAG

[0077] 4GACTGGGACAATGCCATC

[0078] Primer set for SNPRS4988235:

[0079] 1CAGATAAGATAATGTAGC

[0080] 2GTTCCTTTGAGGCCAGGGA

[0081] 3GAGACGATCACGTCATAG

[0082] 4CAAACCCCCTTTTCAAAG

[0083] Primer set for SNPRS713598:

[0084] 1CAATCACTGTTGCTCAGTGC

[0085] 2GT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene detection kit for assessing response of a human body to daily diet. The kit comprises a kit body and reagents which are kept in the kit body in a separated mode, wherein the reagents include the follows: (1) a PCR (polymerase chain reaction) primer group in accordance with SNP (single nucleotide polymorphism) sites of ten genes, (2) a PCR amplification reagent and (3) an agarose gel electrophoresis analysis reagent. According to the detection kit and method disclosed by the invention, a plurality of PCR amplification reactions can be simultaneously conducted on a same PCR instrument through the design of PCR primers, the related genes of a tested object are detected and the high efficiency and the specificity of the detection are achieved, and upon analysis, the gene basis of various nutrient elements affecting the human body are obtained, so as to offer an appropriate diet management scheme to the tested object; and corresponding health risks are assessed and corresponding strategies are adopted so as to avoid invalid, and even harmful, methods. Meanwhile, the detection kit and method can assist professional coaches in managing the diets of athletes.

Description

technical field [0001] The invention relates to gene detection, in particular to a gene detection kit for human body's response to daily diet. Background technique [0002] Nutrition is the material basis to ensure the health and longevity of the human body. The functions of human organs and the normal metabolism of tissues depend on the necessary nutrients, and these nutrients are obtained through a reasonable diet. The "Dietary Guidelines for Chinese Residents" revised and formulated in 1997 puts forward 8 requirements for a reasonable diet, namely, 1. Food should be varied, mainly grains; 2. Eat more vegetables, fruits and potatoes; 3. Eat milk frequently , beans and their products; 4, often eat moderate amounts of fish, poultry, eggs, lean meat, and eat less fatty meat and meat oil; 5, balance food intake and physical activity, and maintain an appropriate weight; 6, eat a light and salt-less diet ; 7, such as drinking should be limited; 8, eat clean, non-deteriorating f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 李则轩朱轶凡邱嘉铭张舒张静静别茜
Owner WUHAN BAIYUAN TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products