Supercharge Your Innovation With Domain-Expert AI Agents!

Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)

A fluorescent quantitative technology for Erysipelas suis, which is applied in the field of animal virology and molecular biology, can solve the problems of inaccurate inoculation location, inaccurate counting, and long detection time, achieving short detection time, fast distinction, high specificity and The effect of sensitivity

Inactive Publication Date: 2017-02-22
WENS FOOD GRP CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The main disadvantage of the viable culture count method is that it takes a long time to detect, and the same vaccine has two antigens with similar nutritional requirements, which will interfere with each other
The length of the test is due to the need for bacterial culture, which takes 24 to 48 hours; after the vaccine is diluted and inoculated on the plate medium, the inoculation position cannot be determined, and the two colonies overlap or cover each other, so the accurate count cannot be counted.
Additionally, bacterial cultures are potentially dangerous

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 Fluorescence quantitative PCR detects primers, probes and methods for Erysipelas suis

[0028] 1, Primer and probe design

[0029] According to the 16S ribosomal gene sequences of seven porcine erysipelas strains registered by NCBI (accession numbers are: AB055908.1, AB055907.1, AB055905.1, NR_040837.1, KP063151.1, KP063150.1 and KJ660062.1) provided Information, through comparative analysis, designed primers F, R and probe P of quantitative PCR, the nucleotide sequence is as follows:

[0030] Upstream primer F: AGGGAATTTTCGGCAATGG (SEQ ID NO: 1);

[0031] Downstream primer R: CCCGAAGGCCKTCTTCA (SEQ ID NO: 2); its K represents T or G;

[0032] Probe P: AAGACTACCGACAAGCCCCACTCACAAC (SEQ ID NO: 3)

[0033] Among them, the 5' end and 3' end of probe P are labeled with FAM and BHQ1, respectively.

[0034] Fluorescent quantitative PCR amplification is carried out by using the above primers and probes, and the Erysipelas suis can be detected through the amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe, a kit and a method for detecting bacillus erysipelatos-suis by a fluorescent quantitative PCR (Polymerase Chain Reaction). The primer is shown as SEQ ID NO: 1 and SEQ ID NO: 2; the probe is shown as SEQ ID NO: 3. The method disclosed by the invention takes DNA (Deoxyribonucleic Acid) of a sample to be detected as a template for carrying out a fluorescent quantitative PCR amplification reaction; fluorescent signals are collected to draw a curve. The primer and the probe for detecting the bacillus erysipelatos-suis have very high specificity and sensitivity, can be used for detecting the bacillus erysipelatos-suis and can also be used for detecting various types of clinical samples, so that a clinical bacillus erysipelatos-suis infection condition can be rapidly monitored; the operation is simple and practical.

Description

technical field [0001] The invention belongs to the technical field of animal virology and molecular biology, and more specifically, the invention relates to a primer, a probe, a kit and a method for detecting Erysipelas suis by fluorescence quantitative PCR. Background technique [0002] Erysipelas suis is an acute, febrile infectious disease caused by Erysipelas suis bacillus, its main features are high fever, acute sepsis, skin rash (subacute), chronic verrucous endocarditis, skin necrosis and multiple non-suppurative Arthritis. This disease was once known as one of the "three major infectious diseases" in my country. In recent years, with the intensive development of pig raising, porcine erysipelas has gradually faded out of people's vision, but the disease has not been completely purified, and it has always occurred in various regions of the country. Occur sporadically, causing serious economic losses to pig farmers. [0003] Porcine erysipelas attenuated vaccine strai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/06C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2563/107C12Q2545/114
Inventor 宋志军罗小飞田小艳孙芝兰吴劲李宋延华潘永飞
Owner WENS FOOD GRP CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More