Supercharge Your Innovation With Domain-Expert AI Agents!

Primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and detection method thereof

A CMV-R2 and soybean technology, applied in the field of genetic engineering, can solve the problem of undiscovered and simultaneous detection of cucumber mosaic virus and common bean mosaic virus, and achieve high sensitivity, strong specificity, and improved detection speed

Active Publication Date: 2018-12-21
SICHUAN AGRI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current detection and monitoring methods mainly include conventional biological detection, immunology and molecular biological detection methods, but there are various degrees of defects and deficiencies, and no method has been found that can detect cucumber mosaic virus (CMV) and soybean mosaic virus simultaneously. Method for three viruses of bean mosaic virus (SMV) and bean common mosaic virus (BCMV)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and detection method thereof
  • Primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and detection method thereof
  • Primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0029] 1. Design primers

[0030] Since the melting temperature between the three pairs of primers may be relatively close, the sequence may appear complementary and other factors, which interfere with the amplification effect. Therefore, after screening, three groups of conserved gene sequences of CMV-870bp, SMV-550bp and BCMV-288bp were selected. Fragment design primers, the specific sequences of which are as follows:

[0031] CMV-F: GGATGCTTCTCCRCGAGDT; (SEQ ID NO. 1)

[0032] CMV-R: GCTGGATGGACAACCCGTTC; (SEQ ID NO. 2)

[0033] SMV-F:AGCTCGCTTCGTCTGGAAAA; (SEQ ID NO.3)

[0034] SMV-R: ATCATCACCCACACGCCATT; (SEQ ID NO.4)

[0035] BCMV-F:GCAACAAAGGAAAAGGYCCTGA; (SEQ ID NO.5)

[0036] BCMV-R: CATACTCGCCCTTCACAGCA. (SEQ ID NO.6)

[0037] 2. Extraction of RNA from soybean leaves

[0038] Take about 0.2 g of soybean leaves, add liquid nitrogen and grind to powder, transfer to Ep tube (placed on ice), add 0.5 mL RNA extraction buffer and 0.5 mL phenol / imitation / isoamyl alc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and a detection method thereof. The primer comprises the following steps: (1), designing the primer with primer sequences shown in SEQ ID NO. 1-6; (2), extracting soybean leaf RNA, and preparing cDNA through reverse transcription; (3), with the cDNA obtained in the step (2) as a template, performing multiplex PCR detection by using the primer in the step (1). The primer designed by the invention is strong in specificity and high in sensitivity, the detection speed of soybean viruses isgreatly increased, and especially when the number of samples to be detected is large, a great convenience is provided for solving the problems of great soybean yield reduction or even no yield causedby the soybean viruses and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a primer for simultaneously detecting three viruses of CMV, SMV and BCMV in soybeans and a detection method thereof. Background technique [0002] Soybean (Glycinemax (L.) Merr) is an important grain and oil crop in my country. According to statistics, 95.526 million tons of soybeans were imported in 2017, and the import dependence rate exceeded 87.7%. It is imminent to increase domestic soybean production. However, in the process of soybean planting, various pests and diseases seriously affect the growth and yield of soybean, among which the losses caused by viruses are very serious. After virus infection, the growth of soybean plants is hindered, the plants are short, the number of pods per plant is reduced, the yield is reduced, and the quality of commodities is reduced. In severe cases, the soybeans have little or no pods, and there are many brown sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2521/107C12Q2537/143
Inventor 尚静赵兰张磊杨文钰贾琦张敏杨辉孔凡磊常小丽杜俊波余靓雍太文
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More