Repair method of iPSCs mitochondrial DNA mutation sites based on mitoTALENs

A technology of mutation site and repair method, which is applied in the field of gene knockout, can solve the problems of tediousness, high off-target rate, cumbersome design, etc., and achieve the effects of improving efficiency, shortening experiment time, and convenient modification work

Inactive Publication Date: 2019-03-22
THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0018] 1. A large number of molecular cloning and sequencing operations are required, which is very cumbersome. Although many commercial companies provide assembled modules, which shortens the construction and experiment cycle, most laboratories are difficult to complete the complete operation of TALEN technology by themselves, which has caused difficulties in its promotion. obstacle;
[0019] 2. The triplex property of ZFN technology, its design is more cumbersome than TALEN, and highly dependent on the target sequence and its upstream and downstream sequences, high off-target rate and high cytotoxicity and other restrictive factors;
[0020] 3. However, CRISPR / Cas technology is context-dependent and can only be applied to targets with upstream PAM sequences;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Repair method of iPSCs mitochondrial DNA mutation sites based on mitoTALENs
  • Repair method of iPSCs mitochondrial DNA mutation sites based on mitoTALENs
  • Repair method of iPSCs mitochondrial DNA mutation sites based on mitoTALENs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] A method for repairing the mitochondrial mutation site of iPSCs derived from a MELAS patient, comprising the following steps:

[0049] (1) Obtaining MiPSCs from patients with Melas syndrome

[0050] The fibroblast reprogrammed (non-transgenic) fibroblasts obtained from the skin of patients with Melas syndrome (containing more than 90% 3243A>G mutation efficiency mtDNA), MiPSCs under the condition of no serum and no feeder layer, and the m3243A>G heterogeneity rate is greater than 80 %.

[0051] Extract the total cell DNA with a DNA extraction kit, the PCR primer sequence used: F: cctcggagcagaacccaacct, R: cgaaagggttgtagtagcccgt, the PCR product of wild type cells is 634bp, when there is a mutation in mitochondrial DNA A3243G, the PCR product can be cut by the endonuclease ApaI into Two sections: 424 and 210bp, software ImageJ for subsequent analysis;

[0052] (2) Determination of the amino acid sequence of TALEN:

[0053]Mitochondrial DNA only encodes 1% of the mitoc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a repair method of iPSCs mitochondrial DNA mutation sites based on mitoTALENs. The method disclosed by the invention has the advantages of high selectivity, high repair efficiency and low miss rate; the repair method can be successfully applied to induced pluripotent stem cells MiPSCs of specific sources of MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis andstroke-like episodes) patients.

Description

technical field [0001] The invention relates to a gene knockout method, in particular to a mitoTALENs-based method for repairing mutation sites in mitochondrial DNA of iPSCs. Background technique [0002] Mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome is one of the most common maternally inherited mitochondrial diseases. Molecular genetic studies have associated the MELAS phenotype with more than 10 mutations in different mitochondrial tRNAs or protein-coding genes, although the majority of patients with MELAS (>80%) were found to have mitochondrial tRNAs Leu has the A3243G mutation in the UUR gene. This mutation is estimated to occur in 1 in 6000 (260 individuals). This mt3243A>G mutation results in impaired mitochondrial translation and protein synthesis, including subunits of the mitochondrial electron transport chain complex leading to impaired mitochondrial energy production (see: Whitehead, M.T., et al., Cortic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N5/10C12N15/11
CPCC12N5/0696C12N15/85C12N2510/00
Inventor 范勇杨翌
Owner THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap