Fragaria X ananassa ABA degradation pathway key enzyme FveCYP707A4a gene and application thereof

A key enzyme, strawberry technology, applied in the field of plant biology, can solve the problems of low average yield and low proportion

Inactive Publication Date: 2019-04-05
浙江五合生物科技有限公司
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] my country's strawberry production can be called "a big strawberry country" in terms of total area and total output, but there is still a ce

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fragaria X ananassa ABA degradation pathway key enzyme FveCYP707A4a gene and application thereof
  • Fragaria X ananassa ABA degradation pathway key enzyme FveCYP707A4a gene and application thereof
  • Fragaria X ananassa ABA degradation pathway key enzyme FveCYP707A4a gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0059] The present invention will be specifically introduced below in conjunction with the accompanying drawings and specific embodiments.

[0060] A key enzyme FveCYP707A4a gene of strawberry ABA degradation pathway,

[0061] The full sequence of the FveCYP707A4a gene is as follows:

[0062] SEQ ID No. 1: FveCYP707A4a

[0063]ATGAAGAAGAGCAAGGGAGGAGGAGAAGAAGACCCCCATGATGATCATGGTCATAAGAATAGGGCGGCTCAGCTCCCTCCAGGCTCATTTGGTTGGCCTTATATCGGTGAGACCCTTCAGCTCTATTCTCAGGACCCAAACACTTTCTTCTCTTCCAGACAGAAAAGGTATGGGAAAATTTTTAAGACACATATACTTGGGAGTCCATGTGTGATGCTGGCGAGCCCGGAGGCTGCAAAGTTTGTATTGGTCACTCAAGCTCACTTGTTCAAGCCCACCTATCCCAAAAGCAAAGAGGCTCTGATTGGTCCCTCCGCATTATTTTTCCACCATGGAGATTACCATTTCAGACTGAGGAAGCTTGTTCAGCGATCTCTCAGTCCTGATGCTATTCGGAATTTGGTGCCCCATATCGACGCCACAGCTGCCTCTGTGACCTCGGAATGGTGGGGCACCGGGAAAGTCATCAACACCTTCCATGAGATGAAGAAGTTTTCTTTCGAAGTTGGTGTACTAGTAATTTTTGGCCAATTGGAGACCCGCTACAAAGAAGAACTGAGGAAAAACTATATGGCAGTGAACAAAGGCTACAATTCATTTCCCATAAACATTCCTGGAACGCCATACAAAAAGGCTTTGTTGGCGAGGGAGAGGCTGAGGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fragaria X ananassa ABA degradation pathway key enzyme FveCYP707A4a gene and application thereof. The application is characterized in that a PCR amplification primer pair isdesigned according to a CDS sequence of the fragariaX ananassa ABA degradation pathway key enzyme FveCYP707A4a gene; PCR amplification is implemented to obtain a FveCYP707A4a gene complete sequence bytaking Fragaria vesca achene cDNA as a template and using the PCR amplification primer pair; a gene for controlling the fragaria X ananassa fruit size is obtained; a silent vector or an overexpression vector is built by using the FveCYP707A4a gene complete sequence; the vector is mixed with an agrobacterium for soaking fragaria X ananassa, so that fragaria X ananassa fruit expansion is restrained, and free ABA content in fragaria X ananassa fruit is lowered in order to adjust the development and maturation of the fragaria X ananassa fruit.

Description

technical field [0001] The invention relates to the field of plant biotechnology, in particular to a key enzyme FveCYP707A4a gene of strawberry ABA degradation pathway and application thereof. Background technique [0002] Strawberry (Fragaria X ananassa) belongs to the Rosaceae Fragaria plant, is one of the important fresh fruit crops, and is also a model species for the study of important functional genes of Rosaceae plants. Follow Giovannoni James J.. 2004. Among them, the regulation of phytohormones is crucial for fruit development and quality formation (Zhong Xiaohong, 2004). [0003] The phytohormone abscisic acid (ABA) can not only promote the sugar absorption of strawberry fruit, but also play an important role in the regulation of strawberry fruit ripening. A B A also plays a central role in other non-climactic fruits. For example, during the ripening of cherry fruit, A B A participates in the growth, development and ripening of the fruit; during the ripening of c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N9/02C12N15/82A01H5/00A01H6/74
CPCC12N9/0071C12N15/8205C12N15/8207
Inventor 何军
Owner 浙江五合生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap