Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel crispr enzymes and systems

A technology of effector proteins and complexes, applied in hydrolases, retroRNA viruses, biochemical equipment and methods, etc.

Pending Publication Date: 2019-08-09
THE BROAD INST INC +1
View PDF368 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although genome editing technologies such as designer zinc fingers, transcription activator-like effectors (TALEs), or homing meganucleases can be used to generate targeted genome perturbations, new strategies and molecular mechanisms that are affordable, easy to set up, and Novel genome engineering technique that is scalable and applicable to targeting multiple locations within the eukaryotic genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel crispr enzymes and systems
  • Novel crispr enzymes and systems
  • Novel crispr enzymes and systems

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[2115] Example 1: Materials and methods of Cpf1 in vivo

[2116] DNA construct

[2117] Has been included by using forward PCR primers

[2118] HA-NLS(aacacaggaccggtgccaccatgtacccatacgatgttccagattacgcttcgccgaagaaaaagcgcaaggtcgaagcgtccacacagttcgagggctttaccaacctgtatcaggtgagc

[2119] (spA)(gcggccgcacacaaaaaaccaacacacagatctaatgaaaataaagatcttttattgaattcttagttgcgcagctcctggatgtaggccagcc)(ref) PCR amplify the sequence (ref) encoding AsCpf1, and clone the resulting PCR template into the (Synapsin) promoter using the human synaptic protein (Synapsin) And generate AAVhSyn-HA-NLS-AsCpf1-spA vector. In order to generate AAVpU6-sgRNA(SapI)-hSyn-GFP-KASH-hGH and pU6-3xgRNA-hSyn-GFP-KASH-hGH vectors, the gene blocks encoding pU6-DR(SapI) and pU6-3xgRNA have been cloned into AAVhSyn- In the GFP-KASH-hGH backbone (unpublished). All constructs have been verified by sequencing. In order to generate the AAVsMecp2-HA-NLS-AsCpf1-spA-tRNAp-3xgRNA vector, the gene block encoding the tRNA promoter (tRNAp)...

Embodiment 2

[2192] Example 2: AsCpf1 is effectively delivered to the brain and mediates editing

[2193] AsCpf1 effectively cuts primary neurons ( figure 1 ). AsCpf1 and guide RNA target the nucleus of neurons after infection. Seven days after infection, multiple cuts were observed in three separate cases. Stereotactic AAV1 / 2 injections for AsCpf1 delivery into the hippocampus of mice also showed virus delivery and GFP fluorescence after 3 weeks of virus delivery ( figure 2 A). Systemic delivery of AsCpf1 and GFP-KASH to adult mice using a two-vector method showed immunostaining 3 weeks after systemic tail vein injection, thus showing the delivery of Syn-GFP-KASH vector to neurons in various brain regions ( Figure 3A ). Next-generation sequencing indel analysis of each brain region dissected 3 weeks after the systemic tail vein co-injection of the dual vector showed indel analysis in each region of the brain at the three target loci. The AAV1 / 2 dual vector was stereotactically injected...

Embodiment 3

[2204] The impact of human genetic variation on CRISPR-based therapeutic genome editing

[2205] method

[2206] data set

[2207] Our target variation analysis was performed using the Exome Aggregation Consortium (ExAC) data set from 60,706 different individuals around the world1. Our research on off-target candidates was conducted using the Phase 3 dataset of the Thousand Genome Project, which contains phased whole genome sequences of 2,504 different individuals around the world2.

[2208] Target Variation Analysis of Whole Exome

[2209] We include all targets in the human exome for the CRISPR enzymes SpCas9-WT, SpCas9-VQR, SpCas9-VRER, SaCas9 and AsCpf1, which are mapped to the protein coding regions of the exons, and the average coverage of each ExAC sample The degree is at least 20 readings. In order to analyze the variation of these targets, as mentioned earlier, we included all missense or synonymous variants 1 that passed the quality filtering in the ExAC data set. Because ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sizeaaaaaaaaaa
molecular weightaaaaaaaaaa
wavelengthaaaaaaaaaa
Login to View More

Abstract

Embodiments disclosed herein are directed to engineered CRISPR-Cas effector proteins that comprise at least one modification compared to an unmodified CRISPR-Cas effector protein that enhances bindingof the of the CRISPR complex to the binding site and / or alters editing preference as compared to wild type. In certain example embodiments, the CRISPR-Cas effector proteinis a Type V effector protein. In certain other example embodiments, the Type V effector protein is Cpfl. Embodiments disclosed herein are directed to viral vectors for delivery of CRISPR-Cas effector proteins, including Cpfl. Incertain example embodiments, the vectors are designed so as to allow packaging of the CRISPR-Cas effector protein within a single vector. There is also an increased interest in the design of compactpromoters for packing and thus expressing larger transgenes for targeted delivery and tissue-specificity. Thus, in another aspect certain embodiments disclosed herein are directed to delivery vectors,constructs, and methods of delivering larger genes for systemic delivery.

Description

[0001] Cross references to related applications [0002] This application requires US provisional patent application 62 / 376,372 filed on August 17, 2016 and US provisional patent application 62 / 437,023 filed on December 20, 2016. [0003] Statement on Federal Government Funding of Research [0004] This invention was made with government support under grant numbers MH100706 and MH110049 granted by the National Institutes of Health. The government has certain rights in this invention. Technical field [0005] The present invention generally relates to systems, methods, and compositions that involve regularly clustered spaced short palindrome repeats (CRISPR) and their components. The present invention also generally relates to the delivery of large payloads, and includes novel delivery particles, especially the use of lipids and viral particles, and novel viral capsids, both of which are suitable for delivering large payloads, such as regular clusters Interval short palindromic repe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C12N15/11C12N15/63
CPCC12N9/22C12N15/113C12N2320/32C12N2310/20C12N15/1089G16B30/00G16B20/00A61K9/1271A61K9/5184C12N7/00C12N15/86C12N15/907C12N2310/32C12N2740/13042C12N2740/13043C12N2800/22
Inventor F·张D·A·斯科特W·X·严S·乔杜里M·海登雷希
Owner THE BROAD INST INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More