Nucleic acid encoding CYP1B1 gene mutant and applications thereof
A nucleic acid and coding technology, applied in the field of genetic engineering, can solve the problem that the detection method needs to be further studied, and achieve the effect of reducing the probability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1 Determining the Pathogenic Mutation of Primary Congenital Glaucoma
[0052] 1. Sample source
[0053] A 2-year-old female child with primary congenital glaucoma (proband) from Fujian Province, China, only one of the probands in the three generations of her family was affected. The inventor selected the patient and her parents for glaucoma gene package detection. The proband was found to have abnormal vision development at the age of 7 months. After specialist examination, he found that the cornea was foggy, the intraocular pressure in both eyes was increased, and the light reflex was slightly slow. The clinical diagnosis was primary congenital glaucoma. The family tree of the patient with primary congenital glaucoma is as follows: figure 1 As shown, the arrow points to the proband, the solid icon indicates the patient, and the semi-solid icon indicates the carrier. Informed consent was obtained from all participants, and venous blood collection was performed...
Embodiment 2
[0066] Example 2 Sanger method sequencing
[0067] Detect the CYP1B1 gene of the primary congenital glaucoma patient described in Example 1: design primers for the c.605C>T mutation of the CYP1B1 gene, and then obtain the mutation site by PCR amplification, product purification and sequencing According to the relevant sequence, according to whether the result of sequence determination is mutant or wild type, the correlation between the c.605C>T mutation of CYP1B1 gene and primary congenital glaucoma is verified.
[0068] Specific steps are as follows:
[0069] 1. DNA extraction
[0070] Refer to the method for extracting DNA described in Example 1.
[0071] 2. Primer design and PCR reaction
[0072] First, refer to the human genome sequence database hg19 / build36.3, and design exon-specific primers for the c.605C>T mutation of the CYP1B1 gene. The specific sequence is as follows:
[0073] Upstream primer F: ATTTCTCCAGAGAGTCAGCTCCG (SEQ ID NO: 3)
[0074] Downstream primer ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com