Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for novel coronavirus droplet type digital PCR detection

A coronavirus and kit technology, applied in the field of new coronavirus detection kits, can solve the problem of low detection sensitivity, and achieve the effect of high detection sensitivity and specificity

Pending Publication Date: 2020-11-13
LANZHOU UNIVERSITY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the detection sensitivity for RdRp, open reading frame 1a / b (open reading frame 1ab, ORF1ab), and envelope protein (Envelope protein, E) genes in the new coronavirus genome is relatively high, while for nucleocapsid protein (nucleocapsidprotein) , N) The detection sensitivity of the gene is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for novel coronavirus droplet type digital PCR detection
  • Kit for novel coronavirus droplet type digital PCR detection
  • Kit for novel coronavirus droplet type digital PCR detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention is explained in detail below.

[0025] See the table for the sequence of two primers and one probe in the kit of the present invention

[0026] The primer sequences contained in the kit of the present invention in table 1

[0027] SEQ ID No.1 N(LZU)(F) AATGCTGCAATCGTGCTACAA SEQ ID No.2 N(LZU)(R) TGATGAGGAACGAGAAGAGGC SEQ ID No.3 N(LZU)(probe) FAM-AGGCTTCTACGCAGAAGGGAGCA-BHQ1

[0028] One, the enforcement of the present invention:

[0029] The implementation process of the kit of the present invention for the detection of new coronavirus by droplet digital PCR:

[0030] (1) Gradient dilution of the template:

[0031] In the present invention, a novel coronavirus nucleic acid standard substance (purchased from China Metrology Institute, GBW(E)091089) is used as a template for detection. The standard material is obtained through in vitro transcription of the important characteristic genes of the new coronavirus ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting a novel coronavirus. According to the detection kit for the droplet type digital PCR technology, at least two amplification primers with sequences shown asSEQ ID No. 1 and SEQ ID No. 2 and a probe with a sequence shown as SEQ ID No. 3 are arranged in the kit. According to the invention, a specific primer and a probe are designed by utilizing an N genomein a COVID-19 gene sequence and are used for a droplet digital PCR technology (ddPCR), and related experiments verify the feasibility and specificity of the primers and the probe. The kit disclosed by the invention can be used as a supplement for detecting the new coronavirus, and has higher detection sensitivity and specificity.

Description

technical field [0001] The invention relates to a kit for virus detection, in particular to a kit for novel coronavirus detection. Background technique [0002] The epidemic of infectious diseases will have a major impact on global public health and have a serious impact on human health. The detection of infectious viruses in the population is the primary task in the prevention and control of the epidemic. To advance, it is necessary to collect environmental samples in densely populated areas such as high-speed rail, stations, and airplanes, and the monitoring of air particles and water samples also needs to be tested. At present, the detection of novel coronavirus (SARS-CoV-2) mainly relies on fluorescent quantitative PCR for detection, but the sensitivity is not high. Some patients have already developed symptoms and still test negative for the virus. However, due to the low content of viral nucleic acid, ordinary PCR is difficult to detect efficiently, and it is prone t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/159C12Q2521/107
Inventor 王德贵王芳午马谢坤沈蓉宋焱峰刘向文
Owner LANZHOU UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More