Anti-HIV-1 P24 recombinant antibody
A CDR-VH2 and CDR-VH1 technology, applied in the field of immunity, can solve the problems of large loss of activity, large amount of monoclonal antibody used, false positive of HIV antibody, etc., and achieve the effect of high affinity and strong binding protein activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0132] This embodiment provides an exemplary preparation method of a recombinant antibody against HIV-1 p24.
[0133] S1. Construction of expression plasmid:
[0134] In this example, the resolved endonuclease is resolved, and the Prime Star DNA polymerase is purchased from TAKARA.
[0135] MagextRactor-RNA extraction kit purchased from ToyoBO; BD Smart TM Race CDNAMPLification Kit kit purchases from Takara;
[0136] PMD-18T vectors are purchased from Takara;
[0137] Plasmid extraction kits were purchased from the mean company;
[0138] Primer synthesis and gene sequencing were completed by Invitrogen.
[0139] S11, the design and synthesis of primers:
[0140] Amplify the top of the 5'race of the heavy chain and light chain:
[0141] Smarter II A Oligonucleotide:
[0142] 5 '> AAGCAGTGTATCAACGCAGAGTACXXXXX <3';
[0143] 5'-Race CDS Primer (5'-CDS): 5 '> (t) 25 VN <3 '(n = a, c, g, ort; v = a, g, orc);
[0144] Universal Primer A Mix (UPM):
[0145] 5 '> CTaatacgactCactataGgcaagc...
Embodiment 2
[0180] Antibody affinity analysis and activity identification
[0181] The antibody (WT) obtained in Example 1 was analyzed having a sequence such as a light chain as shown in SEQ ID NO: 11, and a heavy chain shown in 12.
[0182] After analysis, the complementary decision area of the heavy chain:
[0183] CDR-VH1 is D-S (x1) -S-F-T-P (X2) -Y-T-I (X3) -H;
[0184] CDR-VH2 is I-N-P-Y-N-Q (X1) -T-S-S (X2) -Q-K-F-Q (X3) -G;
[0185] CDR-VH3 is A-R-R (X1) -G-Y-D-R-E-G-Q (x2) -Y-Y-P (X3) -M-D-Y-F (x4) -g;
[0186] Light chain complementary determining area:
[0187] CDR-VL1 is N (X1) -A-S-E-Q (X2) -i-Y-T-F-I (X3) -A;
[0188] CDR-VL2 is T-S (X1) -K-T-I (X2) -A-E;
[0189]CDR-VL3 is Q-H-H-Y-G-L (X1) -P-I (X2) -T-W (x3) -g;
[0190] Among them, X1, X2, X3, X4 are all standby deactivation sites.
[0191] After analysis, the mutant site associated with antibody activity in the above CDR is as follows:
[0192] Table 1 Mutant site associated with antibody activity
[0193]
[0194] The ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


