Molecular markers related to proliferation and metastasis of lung cancer and their application

A diagnostic marker and lung cancer cell technology, which is applied in the direction of medical preparations containing active ingredients, drug combinations, biochemical equipment and methods, etc., to achieve the effect of inhibiting the proliferation of lung cancer cells and increasing the expression level

Active Publication Date: 2022-05-03
CHINA AGRI UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the function of TMEM116 gene and its relationship with cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers related to proliferation and metastasis of lung cancer and their application
  • Molecular markers related to proliferation and metastasis of lung cancer and their application
  • Molecular markers related to proliferation and metastasis of lung cancer and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Detection of TMEM116 Expression in Lung Cancer Tissues and Lung Cancer Cell Lines

[0033] By immunohistochemical technique, the expression of TMEM116 was first detected in lung tissue sections of lung cancer patients. The results showed that the expression of TMEM116 in cancer tissues was significantly higher than that in adjacent tissues ( figure 1 ). Firstly, the paraffin-embedded lung tissue was dewaxed with xylene and hydrated with gradient ethanol, and the tissue antigen was retrieved by microwave high pressure method, and the tissue section was antigen-blocked with serum dilution solution, and TMEM116, CC10, β- Tubulin, α-SMA antibody overnight. On the second day, anti-TMEM116 was used as the 546 red fluorescent secondary antibody, and anti-CC10, β-tubulin and α-SMA was used as the 488 green fluorescent secondary antibody. After incubation at room temperature for 1 hour, observation and photography were carried out through an Olympus microscope. Expe...

Embodiment 2

[0035] Example 2 Construction of TMEM116 knockdown human lung cancer cell line

[0036] By utilizing CRISPR / Cas9 technology, the TMEM116 gene was knocked down in the human A549 lung cancer cell line.

[0037] Using the tool website, several targets for TMEM116 were designed, and after further optimization and screening, three candidate targets were identified, namely target 1: acgggtgcgcttctacccag, target 2: gtatttcccagacagaatac and target 3: cataaagctgactaagccac. Subsequently, the target point was connected to the W2 vector, which contained the G418 drug screening gene, and the three vectors were transformed into A549 lung cancer cells by lipofection method. 48 hours after transfection, G418 drug screening was performed, and the screened cells were harvested 1 week later and DNA was extracted for sequencing detection. The sequencing results showed that the sequence of target 1 was more obvious and had more miscellaneous peaks ( image 3 ), it can be seen that target 1 has t...

Embodiment 3

[0039] Example 3 TMEM116 Knockout Cell Function Verification

[0040] By detecting the proliferation, colony formation, migration and invasion of lung cancer cells, it was found that the above functions of TMEM116 knockdown human lung cancer cells were significantly reduced, see Figure 5 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides molecular markers related to proliferation and metastasis of lung cancer and application thereof. The present invention adopts the gene editing technology CRISPR / Cas9 system. In human lung cancer cell lines, it is found that TMEM116 gene is closely related to the metastasis and proliferation of lung cancer. Lung cancer cell lines. On this basis, through in vitro and in vivo experiments in mice, it was found that the oncogenic ability and metastatic ability of lung cancer cells knocked down by TMEM116 were significantly reduced, the relationship between TMEM116 gene and lung cancer was clarified, and TMEM116 gene was found to be an important factor for the proliferation and metastasis of lung cancer. Related molecular markers are used in the diagnosis of lung cancer, and provide a new method for the diagnosis and treatment of lung cancer.

Description

technical field [0001] The invention relates to the field of medical molecular biology, in particular to the technical field of lung cancer diagnosis, and in particular to molecular markers related to proliferation and metastasis of lung cancer and applications thereof. Background technique [0002] Due to the stimulation of smoking, air pollution and some chemical factors, the normal lung cells of the human body are damaged, and gene mutations are prone to occur in the process of body damage repair, which in turn leads to the occurrence of tumors and cancers. Currently, lung cancer is also one of the most common malignancies, accounting for 18.4% of cancer deaths worldwide. Lung cancer is a highly complex tumor with a generally severe prognosis, with a 5-year survival rate of only 15%. In addition, under the promotion of metabolic changes and immune evasion, lung cancer cells can easily metastasize to other organs through blood vessels and lymphatic vessels, forming second...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/113C12N15/63A61K45/00A61P35/04
CPCC12Q1/6886C12N15/113C12N15/63A61K45/00A61P35/04C12Q2600/106C12N2310/10
Inventor 邢怡明张苏红
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap