Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of ginseng glycosyl transferase in synthesis of stevioside

A technology of glycosyltransferase and stevioside, which is applied in the field of bioengineering, can solve the problems of unseen RE synthesis and achieve the effects of simple operation, high conversion rate and cost reduction

Pending Publication Date: 2021-12-31
SOUTH CHINA UNIV OF TECH
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For the glycosyltransferase mentioned in CN20171087519.7, there is no report on the synthesis of RE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ginseng glycosyl transferase in synthesis of stevioside
  • Application of ginseng glycosyl transferase in synthesis of stevioside
  • Application of ginseng glycosyl transferase in synthesis of stevioside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Construction of recombinant Escherichia coli expressing PgUGT gene

[0057] 1) Synthesize the codon-optimized glycosyltransferase PgUGT gene of Escherichia coli, connect the gene to pET30a by molecular biology methods, and transform it into Escherichia coli Top10 competent, and spread it on LB kanamycin plate (50μg / mLkanamycin) In the process, colony PCR identification was performed on the transformant, and the plasmid was extracted for sequencing verification. The results showed that the pET30a-PgUGT plasmid was constructed.

[0058] 其中糖基转移酶的核苷酸序列为:ATGGATAATCAGAATGGTCGTATTTCAATTGCCCTGTTACCGTTTCTGGCACATGGCCATATTTCACCGTTTTTTGAATTAGCCAAACAGTTAGCCAAACGTAATTGTAATGTGTTTCTGTGTAGTACCCCGATTAATCTGTCAAGCATTAAAGATAAAGATAGCTCAGCCTCTATTAAACTGGTGGAACTGCATCTGCCGAGTAGTCCGGATCTGCCGCCGCATTATCATACCACCAATGGCTTACCCTCCCATCTGATGCTGCCGTTACGCAATGCCTTTGAAACCGCAGGTCCGACCTTTAGCGAAATTCTGAAAACCCTGAATCCGGATCTGCTGATTTATGATTTTAATCCGTCTTGGGCCCCGGAAATTGCCTCATCACATAATATTCCGGCAGTGTATTTTCTGACCACCGC...

Embodiment 2

[0061] Embodiment 2 Recombinant escherichia coli fermentation produces enzyme

[0062] Inoculate recombinant Escherichia coli into 10 mL of LB medium containing 50 mg / L Kanamycin, and culture overnight at 37°C and 250 rpm. Transfer the culture solution to 100mL LB medium containing 50mg / L Kanamycin according to 1% inoculation amount, and cultivate to OD 600 If the temperature is 0.6-0.8, the inducer IPTG is added, and the culture is continued for 20 h at 16°C and 200 rpm.

Embodiment 3

[0063] Example 3 Escherichia coli expresses the acquisition of PgUGT purified protein

[0064] The fermented Escherichia coli cells were collected by centrifugation, washed twice with water, buffer was added, and the cells were broken by an ultrasonic breaker. Centrifuge at 10,000 rpm for 30 minutes at 4°C to obtain the supernatant, and obtain protein fragmentation liquid. Purify the protein fragmentation solution through a nickel column, the results are shown in figure 2 , showing that the target protein can be effectively combined on the nickel column, by containing 20mM imidazole Tris-HCl buffer (pH8. 0) Elution of PgUGT. The purified protein PgUGT was stored at 4°C until use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of ginseng glycosyl transferase in synthesis of stevioside. The amino acid sequence of the glycosyl transferase is as shown in SEQ ID NO.1. The ginseng-sourced glycosyl transferase PgUGT has a new function of catalytically synthesizing rebaudioside E and rebaudioside D, a large amount of rebaudioside E and rebaudioside D can be catalytically synthesized through adoption of an enzyme method, the yield reaches 97.2% or above, the conversion rate is high, the cost is further reduced, operation is easy and convenient, and the ginseng-sourced glycosyl transferase PgUGT is suitable for large-scale popularization and industrial implementation. Glycosyltransferase capable of realizing high-yield expression of the ginseng source is obtained by utilizing genetic engineering, and a cheap and easily available high-activity biological enzyme suitable for industrialization is obtained.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to the application of ginseng glycosyltransferase in synthesizing stevioside. Background technique [0002] As a natural sweetener extracted from the perennial herb Stevia rebaudiana of Asteraceae, steviol glycoside has the advantages of natural source, high sweetness, low calorie, good physiological characteristics and high stability. Studies have shown that steviol glycosides have potential applications in antihypertensive, antidiabetic, dental caries prevention, antitumor, etc. Therefore, their application as sweeteners in food and beverages has attracted widespread attention. At present, steviol glycosides have been approved as food additives in the European Union and the United States. [0003] At present, more than 35 kinds of steviol glycosides have been isolated and identified in Stevia rebaudiana, but most of them have after-bitterness and licorice off-f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/56C12P19/18C12N9/10C12N15/70C12N1/21C12R1/19
CPCC12P19/56C12P19/18C12N9/1048C12N15/70C12N2800/22C12N2800/101
Inventor 林影陈美琪梁书利韩双艳郑穗平
Owner SOUTH CHINA UNIV OF TECH