Application of ginseng glycosyl transferase in synthesis of stevioside
A technology of glycosyltransferase and stevioside, which is applied in the field of bioengineering, can solve the problems of unseen RE synthesis and achieve the effects of simple operation, high conversion rate and cost reduction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Construction of recombinant Escherichia coli expressing PgUGT gene
[0057] 1) Synthesize the codon-optimized glycosyltransferase PgUGT gene of Escherichia coli, connect the gene to pET30a by molecular biology methods, and transform it into Escherichia coli Top10 competent, and spread it on LB kanamycin plate (50μg / mLkanamycin) In the process, colony PCR identification was performed on the transformant, and the plasmid was extracted for sequencing verification. The results showed that the pET30a-PgUGT plasmid was constructed.
[0058] 其中糖基转移酶的核苷酸序列为:ATGGATAATCAGAATGGTCGTATTTCAATTGCCCTGTTACCGTTTCTGGCACATGGCCATATTTCACCGTTTTTTGAATTAGCCAAACAGTTAGCCAAACGTAATTGTAATGTGTTTCTGTGTAGTACCCCGATTAATCTGTCAAGCATTAAAGATAAAGATAGCTCAGCCTCTATTAAACTGGTGGAACTGCATCTGCCGAGTAGTCCGGATCTGCCGCCGCATTATCATACCACCAATGGCTTACCCTCCCATCTGATGCTGCCGTTACGCAATGCCTTTGAAACCGCAGGTCCGACCTTTAGCGAAATTCTGAAAACCCTGAATCCGGATCTGCTGATTTATGATTTTAATCCGTCTTGGGCCCCGGAAATTGCCTCATCACATAATATTCCGGCAGTGTATTTTCTGACCACCGC...
Embodiment 2
[0061] Embodiment 2 Recombinant escherichia coli fermentation produces enzyme
[0062] Inoculate recombinant Escherichia coli into 10 mL of LB medium containing 50 mg / L Kanamycin, and culture overnight at 37°C and 250 rpm. Transfer the culture solution to 100mL LB medium containing 50mg / L Kanamycin according to 1% inoculation amount, and cultivate to OD 600 If the temperature is 0.6-0.8, the inducer IPTG is added, and the culture is continued for 20 h at 16°C and 200 rpm.
Embodiment 3
[0063] Example 3 Escherichia coli expresses the acquisition of PgUGT purified protein
[0064] The fermented Escherichia coli cells were collected by centrifugation, washed twice with water, buffer was added, and the cells were broken by an ultrasonic breaker. Centrifuge at 10,000 rpm for 30 minutes at 4°C to obtain the supernatant, and obtain protein fragmentation liquid. Purify the protein fragmentation solution through a nickel column, the results are shown in figure 2 , showing that the target protein can be effectively combined on the nickel column, by containing 20mM imidazole Tris-HCl buffer (pH8. 0) Elution of PgUGT. The purified protein PgUGT was stored at 4°C until use.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com