Hydrolyzed soy bean isoflavone glycosidase engineering strain, its construction method and its use

A technology of isoflavone glycoside engineering and engineering strains, applied in the directions of genetic engineering, botanical equipment and methods, biochemical equipment and methods, etc.

Inactive Publication Date: 2007-04-11
SHENYANG AGRI UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to use genetic engineering to construct a new engineering strain, in ord

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hydrolyzed soy bean isoflavone glycosidase engineering strain, its construction method and its use
  • Hydrolyzed soy bean isoflavone glycosidase engineering strain, its construction method and its use
  • Hydrolyzed soy bean isoflavone glycosidase engineering strain, its construction method and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0100] Below in conjunction with the accompanying drawings, the specific embodiments, features and effects provided by the present invention will be described in detail as follows: amplify the bgl A gene from the screened high-yielding β-glucosidase lactic acid bacteria, and subclon the gene into pET 28a(+) vector (the vector is pET series), and expressed in E. coli.

[0101] 1. Design and synthesize the following primers according to the experimental requirements:

[0102] BglA F: 5'GAATTCATGACTGACATTACCACGGC 3' (26mer)

[0103] BglA R: 5'AAGCTTTTACGCTTTAATTTTATAA 3' (26mer)

[0104] CTA480 T-R: 5'TTAGCCTTTTCGCCAACATC 3' (20mer)

[0105]BglA f1: 5'TTTGGCTGCTCGCTATGAAG 3' (20mer)

[0106] BglA r1: 5'CTTCATAGCGAGCAGCCAAA 3' (20mer)

[0107] BglA r2: 5'AATCATCTTGCGGTCTTGCC 3' (20mer)

[0108] 2. Extract genomic DNA from lactic acid bacteria using DNAiso (DNA extraction reagent). Take 1 μl for agarose gel electrophoresis, and the results are shown in Figure 1;

[0109] 3. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention belongs to the field of enzyme genetic engineering technology, and is especially hydrolyzed soybean isoflavone glycosidase engineering strain and its construction method and use in producing hydrolyzed soybean isoflavone glycoside. The present invention obtains high activity hydrolyzed soybean isoflavone glycosidase engineering strain through culturing lactic acid bacteria containing beta-glucosidase, extracting glucosidase genome DNA, PCR proliferation, sequencing, subcloning the gene to T vector, final cloning to expression vector and expressing in colibacillus. The obtained engineering bacteria have high enzyme activity, low cost, obvious hydrolysis effect on soybean isoflavone glycoside and high safety, are used in functional food and possess wide application foreground.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering of enzymes, in particular to a hydrolyzed soybean isoflavone glycosidase engineering strain and a construction method thereof, and the strain is applied to the production of hydrolyzed soybean isoflavone glycosides. Background technique [0002] With the improvement of people's living standards and the enhancement of health awareness, soy isoflavone products have been paid more and more attention by people. Soy isoflavones contained in soybean are a kind of important physiologically active substances with strong physiological functions. So far, it is known that there are 12 isomers of isoflavones in soybean, of which 3 are in the form of aglycones and 9 are in the form of glucosides. The content of soybean isoflavones in soybeans is only about 5 / 1000, while 97%-98% of soybean isoflavone isomers are in the form of conjugated soybean isoflavone glycosides, and the total amount of free a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/31C12N15/56C12P1/04C12P17/06
Inventor 刘长江李长彪张春红赵秀红孟宪文高荣海
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap