Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for forecasting treatment effect of epidermal growth factor receptor inhibitor

An epidermal growth factor and kit technology, applied in the field of medicine, can solve problems such as unclear clinical significance, and achieve the effects of reducing medical costs, simple operation, and overcoming blindness.

Inactive Publication Date: 2009-11-25
BEIJING HUAANFO BIOMEDICAL RES CENT +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The clinical significance of such insertion mutations is still unclear (Shigmatsu H,. JNCI, 2005, 97: 339-346)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for forecasting treatment effect of epidermal growth factor receptor inhibitor
  • Kit for forecasting treatment effect of epidermal growth factor receptor inhibitor
  • Kit for forecasting treatment effect of epidermal growth factor receptor inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 Construction of Epidermal Growth Factor Receptor Gene Wild / Mutant Genotype Positive Control Plasmid

[0071] Materials and methods

[0072] Instruments: centrifuge (Eppendorf 5415D), PCR instrument (ABI 2700), gel imaging system (Huadian DH2000)

[0073] Materials: pET28 vector plasmid, E. coli strain DH5α

[0074] Steps:

[0075] 1. Tissue genomic DNA extraction:

[0076] The paraffin-embedded non-small cell lung cancer tumor tissue was selected, and after dewaxing, the genomic DNA in the tumor tissue was extracted using a DNA extraction kit (QIAmp DNA kit).

[0077] 2. Amplification of EGFR exon 18 gene fragment

[0078] To amplify the epidermal growth factor receptor target gene fragment, use the following primers to amplify the EGFR exon 18 gene fragment.

[0079] SEQUENCE 5: CTCGAATTCTCCAATGAGCTGGCAAGTG,

[0080] SEQUENCE 6: TCCAAGCTTTCCCAACACTCAGTGAAACAAA

[0081] At the 5' end of the primers, respectively contain restriction sites for EcoR1 and H...

Embodiment 2

[0097] Example 2 Determination of the genotype of non-small cell lung cancer samples using the kit

[0098] 1. Sample preparation: Genomic DNA was extracted from 46 tumor tissues (fresh tissues or paraffin blocks) of non-small cell lung cancer patients taking gefitinib.

[0099] 2. Configuration of PCR amplification mixture

[0100] Configure the PCR amplification mixture according to Table 1.

[0101] 46 PCR reaction mixtures were prepared respectively. In addition, positive control sample mixtures of two genotypes and a negative sample mixture were prepared.

[0102] Table 1 PCR amplification mixture configuration table

[0103] components

Volume ul

Taq DNA polymerase 5U / ul

0.5

10×PCR buffer

2.5

Mg2+25mM

3

dNTP 1.25mM

4

Primer 1SEQUENCE3

0.4

Primer 2SEQUENCE4

0.4

Probe 1SEQUENCE1

0.25

Probe 2SEQUENCE2

0.25

DNA template

11.25

h 2 o

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a kit for forecasting the treatment effect of an epidermal growth factor receptor inhibitor, in particular to a specific primer and a probe for detecting the G719S polymorphism locus of an eighteenth exon of an epidermal growth factor receptor gene by a PCR method, application of the same in preparing a reagent for detecting the G719S polymorphism locus of the eighteenth exon of the epidermal growth factor receptor gene through a PCR amplified biological sample, a kit for detecting the G719S polymorphism of the eighteenth exon of the epidermal growth factor receptor gene and application of the kit, and belongs to the field of medicaments.

Description

technical field [0001] The invention relates to predicting the curative effect of epidermal growth factor receptor inhibitor drugs by detecting the gene polymorphism of epidermal growth factor receptor. The invention belongs to the field of medicine. Background technique [0002] Pharmacogenomics mainly studies the different reactions of different patients to drugs caused by gene mutations, and develops new drugs or new medication methods on this basis. Pharmacogenomics is different from genetics in the general sense. Its main purpose is not to discover the human genome, but to use known genetic theories to improve the treatment of patients relatively simply. Pharmacogenomics cannot simply be regarded as a test to predict the predisposition to disease, or to provide statistical data for predicting the risk of disease. It is to study the influence of related genes on the drug action itself and the relationship with gene variation. These variations are the root cause of diff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 张彦明于多王燕徐希平
Owner BEIJING HUAANFO BIOMEDICAL RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com