A dnazyme-mediated method for normalized subtractive hybridization of cDNA

A technology of DNase and hybridization method, which is applied in the field of cDNA homogenization and subtractive hybridization, which can solve the problems of easy loss of information, inability to subtract non-target molecules, high false positive rate, etc., and achieve high-efficiency enrichment and high-subtraction efficiency.

Inactive Publication Date: 2011-12-21
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods have some disadvantages: DD can only obtain partial cDNA sequences of a few genes at a time, and the false positive rate is high; RDA cannot effectively eliminate non-target molecules, and the false positive rate is also high, and more It is conducive to the enrichment of genes with high expression levels, and it is easy to lose the information of genes with low expression levels; SAGE requires a large number of sequencing and analysis of a large amount of sequence information, and the length of the obtained sequences is currently only a dozen base pairs (bp). , the later research still needs a lot of work; SSH is more efficient than RDA, and can also have a certain homogenization effect on the content of cDNA with different expression levels, but the strength of inhibitory PCR is controlled by many factors 5 , In addition, SSH is also easy to lose the information of low-expression genes
In addition, none of the above-mentioned methods can obtain full-length cDNA, so it is easy to lose information during sequence alignment; for genes that need to be studied in depth, obtaining full-length cDNA is also necessary

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A dnazyme-mediated method for normalized subtractive hybridization of cDNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Analysis of Artemia dormant reproduction-specific expression genes

[0036] The sequences of the primers (10 μM) used are shown in Table 1:

[0037] Primer

Sequence (5'-3')

TsOligo-p

G TAATACGACTCACTATAGGG GG-p

T7oligod T

G TAATACGACTCACTATAGGG GGTTTTTTTTTTTTTTTVN

SOI

CTGCAGCGAACCAATCCCTCTG TAATACGACTCACTATAGGG

P.I.

CTGCAGCGAACCAATCCCTCTG

SalT7P

GATCGTCGACG TAATACGACTCACTATAGGG

SP6T7

CATTTAGGTGACACTATAGAG TAATACGACTCACTATAGGG

Tspa

TGGTTGGACTCGGTTTGGACGCCATAGAATTGGTTTTTTTTTTTTTTTVN

3'ap

TGGTTGGACTCGGTTTGGACG

[0038] Note: The T7 promoter sequence is underlined, and the 3' end of the primer TsOligo-p is phosphorylated.

[0039] The purpose of this experiment is to isolate genes specifically expressed in dormant reproduction in Artemia parthenogenetica (Gahai Lake, China).

[0040] (1) Synthesizing the first-strand cDNA.

[0041] Two groups of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cDNA homogeneous subtractive hybridization method mediated by double-strand specific DNase, which sequentially comprises the synthesis of first-strand cDNA, synthesis of double-stranded cDNA, transcription of RNA, reverse transcription, homogenization and subtractive hybridization, and double-strand cDNA synthesis. Specific DNase digestion, PCR amplification, cloning and identification of differentially expressed genes and other steps. Compared with other methods, the beneficial effects of the present invention are mainly reflected in: (a) high reduction efficiency for co-expressed genes, efficient enrichment for differentially expressed genes, and differentially expressed genes with very low expression levels can be effectively enriched; (b) A full-length cDNA sequence can be obtained.

Description

(1) Technical field [0001] The invention relates to a double-strand specific DNase-mediated cDNA normalized subtractive hybridization (Duplex-specific nuclease-mediated normalization and subtractive hybridization, DNSH) method. (2) Background technology [0002] Different tissues or cells of an organism, and the same tissue or cell will selectively express some genes under different developmental stages and stress conditions. These genes with different expression levels or expression periods are called differentially expressed genes (differentially expressed genes) . Cloning and identification of differentially expressed genes can effectively promote the study of the mechanism of individual development, differentiation, carcinogenesis and other processes. Currently, the methods for screening differentially expressed genes mainly include differential display (DD), representational difference analysis (RDA), serial analysis of gene expression (SAGE) and suppression subtractiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C40B50/06C12Q1/68C12P19/34C12R1/19
Inventor戴忠敏杨卫军
OwnerZHEJIANG UNIV