Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant human kallidinogenase

A technique of pancreatic kallikrein and recombinant protein, which is applied in the field of recombinant human kallikrein and its new preparation, can solve the problems of unknown effect of enzyme activity, difficulty in collecting human urine, sharp drop in blood pressure of patients, etc. Excellent efficacy, reduced side effects

Inactive Publication Date: 2011-02-09
GUANGDONG TECHPOOL BIO-PHARMA CO LTD
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its amino acid composition is the same as the amino acid sequence of human pancreatic kininogenase, but there are Glu / Lys two amino acids at the 162 position of the kininogenase protein extracted from human urine. Effect of activity unknown
The clinical use of human urinary kininogenase found that too fast intravenous infusion would lead to adverse side effects such as a sharp drop in blood pressure, which brought certain risks to patients
In addition, it is difficult to collect human urine, and human urine protein resources are very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human kallidinogenase
  • Recombinant human kallidinogenase
  • Recombinant human kallidinogenase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Cloning of human pancreatic kininogenase gene (KLK1 gene)

[0038] Materials and methods: Using human kidney total RNA as a template, the full-length cDNA of KLK was first obtained through a reverse transcription kit (Invitrogen, USA). Then using the cDNA as a template, first amplify the two fragments of 1-496bp (taking ATG as 1) and 476-789bp of KLK respectively, and then use the 5' and 3' end primers to splice the two fragments into Complete KLK gene. PCR reaction conditions for amplifying the KLK fragment: denaturation at 94°C for 3 minutes; 30s at 94°C; 30s at 62°C; 30s at 72°C; 34 cycles of amplification;

[0039] The reaction was terminated after extending for 5 min at 72°C.

[0040] The primers used to amplify KLK 1-496 are:

[0041] Upstream primer: 5'GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGTCCCGGATTGTGG3'

[0042] Downstream primer: 5'AATTCTCTGGTTCGATGCTGC 3'

[0043] The primers used for PCR amplification of 476-789bp fragments are:

[...

Embodiment 2

[0052] Embodiment 2: Contain the construction of recombinant KLK1 gene expression plasmid

[0053] The full-length KLK1 gene was inserted into the Xho I and EcoR I sites of the vector pcDNA3.1 / myc-His(-)A containing a strong CMV promoter, and the pcDNA3.1-KLK1 eukaryotic expression plasmid was constructed.

[0054] Primers used to construct pcDNA3.1-KLK1:

[0055] Upstream primer: 5'GTGA CTCGAG ACCATGGGGTTCCTGGTTCTGTGC 3' (Xho I restriction site is underlined)

[0056] Downstream primer: 5'ATCT GAATTC TCAGGAGTTCTCCGCTATGGTGTC 3' (the underline is the EcoR I restriction site).

[0057] In addition, in order to construct a fusion protein containing human pancreatic kininogenase and human IgG1 Fc fragment in order to express more stable in vivo, the human IgG1 Fc fragment was inserted at the EcoR I and BamH I sites of pcDNA3.1-KLK1 to construct The pcDNA3.1-KLK1-Fc eukaryotic expression plasmid was obtained. The Fc fragment is located at the C-terminus of the KLK1 gene, co...

Embodiment 3

[0058] Example 3: Expression and preparation of recombinant human pancreatic kininogenase in eukaryotic cells

[0059] method:

[0060] 1. Expression of KLK1 gene in CHO cells:

[0061] CHO cells were cultured in DMEM medium containing 10% fetal bovine serum in 5% CO 2 , Incubated at 37°C. Cationic liposomes (LipofectAMINE 2000, Invitrogen Corporation) were used to transfect CHO cells with the pcDNA3.1-KLK eukaryotic expression plasmid prepared in Example 2, and to screen transfected cells with G418; and then to identify G418 by enzyme activity assay and Western Blot Screened monoclonal stable cell lines.

[0062] 2. Large-scale culture of host cells expressing recombinant human pancreatic kininogenase:

[0063] a) The cell line containing the expressed recombinant protein is cultured with DMEM medium (pH7.20) containing 5% fetal bovine serum, and subcultured in a serum-free medium using a conventional method, and then cultured in small-scale suspension batches , placed i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to human kallidinogenase and a production method thereof. The recombinant human kallidinogenase is produced by using molecular biological technology and host cells for expressing recombinant proteins and by purifying the recombinant proteins by using affinity chromatography. The recombinant human kallidinogenase has various applications in clinic, and the side effect of the recombinant human kallidinogenase is reduced obviously.

Description

technical field [0001] The invention relates to a recombinant human pancreatic kininogenase and a new preparation method thereof. More specifically, the present invention relates to the use of molecular biology techniques to obtain host cells expressing recombinant human pancreatic kininogenase, to produce host cells by large-scale cell culture or fermentation methods, and to use affinity layers from cells or extracellular secretions The recombinant human pancreatic kininogenase is extracted by the method of analysis. The sugar chain structure of the recombinant human pancreatic kininogenase is more complex than that of natural protein extracted from human urine. It has multiple clinical uses and less side effects. Background technique [0002] The human kininogenase gene is a large multi-gene family consisting of at least 15 genes (KLK1-KLK15). However, only the protein encoded by the pancreas / kidney kininogenase gene (KLK1 gene) has kininogenase activity, and almost none ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63A61K38/49C12N9/48C12N15/58A61P9/10
Inventor 傅和亮侯永敏吴蓉蓉王晓岩
Owner GUANGDONG TECHPOOL BIO-PHARMA CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More